helpful_commands

Check Links GitHub Super-Linter

Command-line tools, commands, and code snippets for performing routine data processing and bioinformatics tasks.

Table of Contents

awk

Add a header line to a file

awk 'BEGIN{print "my header text"}1' input.txt

Add up the values in a column

In this example values in column 5 are summed in a file with columns separated by one or more blank spaces:

awk -F' {1,}' '{sum+=$5} END {print sum}' input.txt

Convert a CSV file to a FASTA file

In this example column 1 contains the sequence title and column 3 contains the sequence:

awk -F, '{print ">"$1"\n"$3"\n"}' input.csv

Create a new column from two existing columns

In this example the values in columns 3 and 4 are added to create a new column:

awk -F, '{print $0,$3+$4}' input.txt

Extract sequences from a multi-FASTA file based on title

In this example the sequence titles to extract (X and Y) are listed in the file ids.txt:

X
Y

The sequences are extracted from the file ARS-UCD1.2_Btau5.0.1Y.fa:

awk -F'>' 'NR==FNR{ids[$0]; next} NF>1{f=($2 in ids)} f' ids.txt ARS-UCD1.2_Btau5.0.1Y.fa

For each category in one column, add up the values in another column

In this example values in column 2 are summed up for each category in column 1:

awk -F, '{a[$1]+=$2}END{for(i in a) print i,a[i]}' input.csv

In this example the first row of the input file contains the column names:

awk -F $'\t' 'NR>1{exit};{for (i = 1; i <= NF; i++) print "column " i,"is " $i}' input.tab

In this example lines are printed when the value in column 1 equals 9913:

awk -F, '{if ($1 == 9913) print $0}' input.csv

To also print all lines starting with # (header lines for example), use:

awk -F, '$1 ~ /^#/ {print; next} {if ($1 == 9913) print $0}' input.csv

Print the first line and lines when the value in column 1 equals 9913:

awk -F, 'NR==1; NR > 1 {if ($1 == 9913) print $0}' input.csv

In this example the value in column 2 is printed when column 1 contains text that matches comp:

awk -F, '$1 ~ /comp/ { print $2 }' input.csv

In this example lines where column 2 equals 7 and column 3 is between 60240145 and 60255062 are printed:

awk -F, '{ if ($2 == 7 && $3 >= 60240145 && $3 <= 60255062) print $0 }' input.csv

In this example the header line is printed, followed by lines where column 2 starts with MT- and column 3 starts with MT-:

awk -F $'\t' 'NR==1{print; next} $1~/^MT-/ && $2~/^MT-/' input.tab

In this example the columns named Affy SNP ID and Flank are printed:

awk -F, 'NR==1 { for (i=1; i<=NF; i++) { ix[$i] = i } } NR>1 { print $ix["Affy SNP ID"]","$ix["Flank"] }' input.csv
awk '/^[^#]/ { print $0;exit; }' input.txt

In this example the lines coming after a line starting with IlmnID and before a line starting with [Controls] are printed:

awk -F, '/^IlmnID/{flag=1;print;next}/^\[Controls\]/{flag=0}flag' input.csv
awk 'NR%4==2{sum+=length($0)}END{print sum/(NR/4)}' input.fastq
awk -F $'\t' '{count[NF]++}END{for(j in count) print "line length " j,"("count[j]" counts)"}' input.tab

In this example the counts for each distinct value in column 9 are printed:

awk -F $'\t' '{count[$9]++}END{for(j in count) print j"\t"count[j]}' input.tab

Same as above but skipping the first line and formatting the output to increase readability:

awk -F $'\t' 'NR>1{count[$9]++}END{for(j in count) printf "%-20s %s\n",j,count[j]}' input.tab

In this example the counts for each distinct pair of values in column 1 and column 2 are printed:

awk -F $'\t' '{count[$1"\t"$2]++}END{for(j in count) print j"\t"count[j]}' input.tab

Replace certain values in specific columns

In this example 1 and -1 in column 23 are replaced with forward and reverse, respectively:

awk -F\\t 'BEGIN {OFS = "\t"} {sub(/^1/, "forward", $23); sub(/^-1/, "reverse", $23); print}' input.tab

Reverse the order of lines in a file using awk

awk '{a[i++]=$0} END {for (j=i-1; j>=0;) print a[j--] }' input.txt

In this example the contents of the file are printed except for the last 15 lines:

awk 'NR>c{print A[NR%c]} {A[NR%c]=$0}' c=15 input.txt

Skip header lines

The following skips lines starting with #:

awk '/^[^#]/ { print $0 }' input.txt

The following skips the first 5 lines:

awk 'FNR > 5 { print $0 }' input.txt

Sort lines based on order of IDs in another file

In this example the records in file_to_sort.csv have an identifier in column 1 that is present in sorted_ids.txt, which has a single column:

awk -F, 'NR==FNR {a[$1]=$0; next} ($0 in a) {print a[$0]}' file_to_sort.csv sorted_ids.txt

If both files have a single header line the following can be used to generate the sorted output with the restored header line:

(head -n 1 file_to_sort.csv && awk -F, 'NR==FNR {a[$1]=$0; next} ($0 in a) {print a[$0]}' <(tail -n +2 file_to_sort.csv) <(tail -n +2 sorted_ids.txt)) > sorted.csv

Write each row to a separate file named after the value in a specific column

In this example each file is named after the value in column 1:

awk -F $'\t' '{ fname = $1 ".txt"; print >>fname; close(fname) }' input.tab

Bash

Change Bash prompt temporarily

PS1="$ "

Check Bash scripts for potential issues

Use shellcheck:

shellcheck some_script.sh

Extract a file

The following Bash function can be used to extract a variety of file types:

extract() {
  if [ -f "$1" ]; then
    case "$1" in
    *.tar.bz2) tar xjf "$1" ;;
    *.tar.gz) tar xzf "$1" ;;
    *.bz2) bunzip2 "$1" ;;
    *.rar) unrar e "$1" ;;
    *.gz) gunzip "$1" ;;
    *.tar) tar xf "$1" ;;
    *.tbz2) tar xjf "$1" ;;
    *.tgz) tar xzf "$1" ;;
    *.zip) unzip "$1" ;;
    *.Z) uncompress "$1" ;;
    *.7z) 7z x "$1" ;;
    *) echo "'$1' cannot be extracted via extract()" ;;
    esac
  else
    echo "'$1' is not a valid file"
  fi
}

Extract part of filename

In this example the filename NS.2035.002.IDT_i7_9---IDT_i5_9.2032929-45-1_R1.fastq.gz contains the sample name 9.2032929-45-1.

To obtain the sample name:

file=NS.2035.002.IDT_i7_9---IDT_i5_9.2032929-45-1_R1.fastq.gz

# remove from the start up to and including the first i5_
without_upstream=${file#*i5_}

# remove from the end up to and including the first _
without_upstream_and_downstream=${without_upstream%_*}

# check the result
# 9.2032929-45-1
echo $without_upstream_and_downstream

Perform a calculation on the command line

Use Bash arithmetic expansion:

n=6
echo "$(( n - 1 * 2 ))"
answer="$(( n - 1 * 2 ))"

Redirect STDERR to STDOUT and view both and append both to a file

some_command 2>&1 | tee -a log

Run groups of commands in parallel using a Bash function and xargs

The following code processes sequence files using filtlong. Files are processed in parallel using xargs and a Bash function called process_file:

# Define the directory paths
input_dir="fastq-input"
output_dir="filtlong-output"

# Define the number of processes
num_processes=10

# Define a function to process each file
process_file() {
    input="$1"
    # Create a unique log file for this process
    log_file="${output_dir}/$(basename "${input}").log"

    # Extract the directory part from the log file path and create the directory
    log_dir=$(dirname "${log_file}")
    mkdir -p "${log_dir}"  # Ensure the log file's directory exists

    # Get the relative path of the input file
    relative_path=${input#${input_dir}/}

    # Get the directory and filename of the relative path
    relative_dir=$(dirname "${relative_path}")
    relative_file=$(basename "${relative_path}")

    echo "Processing ${relative_file}..." >> "${log_file}"

    # Define the output file
    output="${output_dir}/${relative_dir}/${relative_file}"

    # If the output file already exists, inform and skip
    if [[ -f "${output}" ]]; then
        echo "Output file ${output} already exists, skipping ${relative_file}..." >> "${log_file}"
        return 0 # Skip this file
    fi

    # Create the corresponding directory in the output directory if it doesn't exist
    mkdir -p "${output_dir}/${relative_dir}"

    # Run filtlong and pipe the results into bgzip, then write the results to the output file
    # Direct process output to individual log file
    if filtlong --min_length 200 "${input}" 2>> "${log_file}" | bgzip > "${output}"; then
        echo "Writing output to ${output}..." >> "${log_file}"
    else
        echo "Error processing ${input}..." >> "${log_file}"
    fi
}

# Export the function so it can be used in subshells
export -f process_file

# Export the output directory so it can be used in subshells
export output_dir

# Export the input directory so it can be used by subshells
export input_dir

# Find each .fq.gz file in the input directory and its subdirectories, then use xargs to process them in parallel
find "${input_dir}" -name "*.fq.gz" -print0 | xargs -0 -n 1 -P "${num_processes}" -I {} bash -c 'process_file "$@"' _ {}

The above processes compressed FASTQ files from an input directory.

The filtlong output generated for each input file is compressed using bgzip and written to a separate file. The script creates an output directory structure to match the input directory structure. For example, if the input file is fastq-input/sample1/sample1.fq.gz, the output file will be written to filtlong-output/sample1/sample1.fq.gz.

For every file processed, a unique log file is created within the output directory.

Input files are not processed if their output folder already exist in the output directory.

Save the output of a command in a variable

Use a subshell:

result=$(echo "sqrt(16)" | bc -l)

Set variables using values from a CSV file

The first read in the example below is used to skip a header line.

{
  read
  while IFS="," read -r column1 column2 column3
  do
    echo "$column1, $column2, $column3"
  done
} < "input.csv"

In this example gene names and accessions are read from a file and stored in parallel arrays that are then used to construct esearch and efetch commands that download the sequences.

Sample input, stored in queries.csv:

narG,NP_415742.1
nirK,WP_010967660.1
nirS,NP_249210.1
nosZ,NP_252082.1

Read gene names and accessions from queries.csv and store in parallel arrays:

gene=()
accession=()
while IFS=',' read -ra array; do
  gene+=("${array[0]}")
  accession+=("${array[1]}")
done < "queries.csv"

Check the contents of the arrays:

printf '%s\n' "${gene[@]}" "${accession[@]}"

Use the values stored in the arrays to construct esearch and efetch commands that download each sequence using the accession and save the sequence to a file named after the gene:

for i in "${!gene[@]}"; do
  printf "processing gene %s and accession %s\n" "${gene[i]}" "${accession[i]}"
  esearch -db protein -query "${accession[i]}[ACCESSION]" | efetch -format fasta > ${gene[i]}.faa
  sleep 1
done

A simpler approach is to use parallel.

View STDOUT and append it to a file

some_command | tee -a output.txt

brew

Add a third-party repository

In this example brewsci/bio for bioinformatics software:

brew tap brewsci/bio

Install a graphical application

In this example the Firefox browser:

brew install firefox --cask

Install a package

In this example parallel:

brew install parallel

Install directly from a third-party repository

In this example clustal-w from brewsci/bio:

brew install brewsci/bio/clustal-w

List installed graphical applications

brew list --cask

List installed packages

brew list

View available graphical applications

To view graphical applications available from the cask tap via the Homebrew package manager for macOS:

View available packages

To view packages available from the core tap via the Homebrew package manager for macOS:

View packages available from brewsci/bio

Conda

Activate an environment

conda activate ngs

Add additional packages to an environment

conda activate ngs
conda install -y -c bioconda -c conda-forge picard

Create a conda environment from a yaml file

conda env create --file env-environment.yaml

Create an environment and install some packages

In this example an environment called ngs is created:

conda create -y --name ngs
conda activate ngs
conda install -y -c bioconda -c conda-forge multiqc fastqc trimmomatic bowtie2 subread samtools

Deactivate an environment

conda deactivate

Export an environment to a yaml file

Use the export command while the environment is active:

conda env export > env-environment.yaml

Install Miniconda

wget https://repo.anaconda.com/miniconda/Miniconda3-latest-Linux-x86_64.sh
bash Miniconda3-latest-Linux-x86_64.sh -b
source ~/miniconda3/bin/activate
conda init
source ~/.bashrc
conda update -y -n base -c defaults conda

To install Conda with included support for Mamba, use Miniforge.

List available packages

conda search -c bioconda -c conda-forge

List environments

conda info --envs

List packages installed in the active environment

conda list

Remove an environment

In this example the environment to remove is called my-env:

conda deactivate
conda env remove --name my-env

Search for a specific package

conda search -c bioconda -c conda-forge blast

Create an environment on Apple silicon when packages are not available

If packages are not available for osx-arm64 use conda config --env --set subdir osx-64. For example:

conda create -y --name vcf
conda activate vcf
conda config --env --set subdir osx-64
conda install -y -c conda-forge -c bioconda bcftools vcftools tabix

csvkit

The csvkit examples below are taken from the csvkit documentation.

Convert Excel to CSV

in2csv data.xls > data.csv

Convert JSON to CSV

in2csv data.json > data.csv

Convert to JSON

csvjson data.csv > data.json

Find rows with matching cells

csvgrep -c phone_number -r "555-555-\d{4}" data.csv > new.csv

Generate summary statistics

csvstat data.csv

Merge CSV files on a specified column or columns

csvjoin -c ID file1.csv file2.csv > inner_join_on_ID.csv

By default csvjoin performs an inner join. Other joins can be performed using --outer, --left, and --right.

csvcut -n data.csv

Query with SQL

csvsql --query "select name from data where age > 30" data.csv > new.csv

Reorder columns

csvcut -c column_c,column_a data.csv > new.csv

Select a subset of columns

csvcut -c column_a,column_c data.csv > new.csv

cut

Change field separators

cut can also be used to change the field separator. In this example tab-delimited values are changed to comma-separated values:

cut -d $'\t' -f 1- --output-delimiter=',' bovine_genotypes.vcf

To switch from comma-separated to tab-separated use:

cut -d, -f 1- --output-delimiter=$'\t' sequenced_samples.csv

On platforms lacking --output-delimiter perl can be used to switch tabs to commas:

perl -p -e 's/\t/,/g' sequenced_samples.csv

To switch commas to tabs when --output-delimiter isn't available the command below can be used. This script handles cases when commas are inside of quoted fields:

perl -nle  'my @new  = (); push( @new, $+ )
while $_ =~ m{"([^\"\\]*(?:\\.[^\"\\]*)*)",?
| ([^,]+),? | ,}gx; push( @new, undef )
if substr( $text, -1, 1 ) eq '\'','\'';
for(@new){s/,/ /g} print join "\t", @new' sequenced_samples.csv

Extract a range of columns

In this example columns 3, 10, 11, and 12 are extracted from a tab-delimited file:

cut -d $'\t' -f 3,10-12 bovine_genotypes.vcf

Extract characters

Here cut is used to extract the first three characters from each line:

cut -c 1-3 sequenced_samples.csv

Extract columns of interest

In this example columns 1 and 2 are extracted from a from a CSV file:

cut -d, -f 1,2 sequenced_samples.csv

Extract everything except one column

In this example all columns except column 1 are returned (the -f 2- is used to mean "from field 2 to the end"):

cut -d $'\t' -f 2- bovine_genotypes.vcf

datamash

GNU datamash is a command-line program which performs basic numeric, textual and statistical operations on input textual data files.

Group records by one column and print information about each group

In the following example the input CSV file has a header line. Records are grouped based on the value in column 2, and for each group the mean value of column 5 is printed:

datamash -H -t, -g 2 mean 5 < example.csv

In the following example all the values in column 5 are printed for each group:

datamash -H -t, -g 2 collapse 5 < example.csv

In the following example a variety of statistics are generated for column 5:

datamash -H -t, min 5 q1 5 median 5 q3 5 max 5 count 5 mean 5 sstdev 5 < example.csv

Transpose

The following uses transpose to swap rows and columns in a CSV file with a header row:

datamash -H -t, transpose < example.csv

Docker

Annotate a bacterial genome using Bakta

Download a Bakta Docker image:

docker pull oschwengers/bakta

Prepare the Bakta database (the --type argument can be light or full):

docker run --rm -v "$(pwd)":/dir -u "$(id -u)":"$(id -g)" -w /dir -e PATH=/opt/conda/bin/ --entrypoint=/opt/conda/bin/bakta_db oschwengers/bakta download --output my_database --type light

Annotate the genome. In this example the genome sequence to be annotated is in a file called UAMS_ABS94.fna, located in the current directory:

docker run --rm -v "$(pwd)":/dir -u "$(id -u)":"$(id -g)" -w /dir oschwengers/bakta --db my_database/db-light --output UAMS_ABS94 UAMS_ABS94.fna

Annotate a bacterial genome using Prokka

Download a Prokka Docker image:

docker pull staphb/prokka:latest

Create a container from the image and run prokka to annotate the sequence. In this example the genome sequence to be annotated is in a file called sequence.fasta, located in the current directory, and four CPUs are used:

docker run --rm -v "$(pwd)":/dir -u "$(id -u)":"$(id -g)" -w /dir staphb/prokka:latest prokka sequence.fasta --cpus 4

Compare sequence reads to a bacterial genome to find SNPs using Snippy

Download a Snippy Docker image:

docker pull quay.io/biocontainers/snippy:4.6.0--hdfd78af_1

Create a container from the image and run snippy to find SNPs. In this example the reference sequence is in a file called sequence.gbk, and the reads are in J10_S210_R1_001.fastq and J10_S210_R2_001.fastq:

docker run -it --rm \
-u "$(id -u)":"$(id -g)" \
-v "$(pwd)":/directory \
-w /directory \
quay.io/biocontainers/snippy:4.6.0--hdfd78af_1 \
snippy --cpus 4 --outdir output --reference sequence.gbk --R1 J10_S210_R1_001.fastq --R2 J10_S210_R2_001.fastq

Convert documents using Pandoc

Download a Pandoc Docker image:

docker pull pandoc/extra

Create a container from the image and run pandoc to convert a Markdown file to a PDF file. In this example the Markdown file is called example.md and the PDF file is called example.pdf:

docker run --rm -v "$(pwd)":/dir -u "$(id -u)":"$(id -g)" -w /dir \
pandoc/extra:latest \
example.md -o example.pdf \
--pdf-engine xelatex \
--template eisvogel.tex \
-H head.tex \
--highlight-style zenburn \
-M "colorlinks: TRUE" \
-M "code-block-font-size: \scriptsize" \
-M "date: `date +%Y-%m-%d`" \
-M "author=$AUTHOR" \
-M "title=$TITLE"

Delete all containers that are not running

docker container rm $(docker ps -a -q)

Delete all images

docker system prune --all

Get an interactive bash shell in a Docker container

docker run -it quay.io/biocontainers/snippy:4.6.0--hdfd78af_1 /bin/bash

Or

docker run --rm -it --entrypoint bash nidhaloff/igel

Kill all running containers

docker container kill $(docker ps -q)

Or to continually kill containers:

while true; do docker container kill $(docker ps -q); sleep 2; done

List images

docker image ls

List running containers

docker container ls

Override the entrypoint

Use the --entrypoint option to override the entrypoint. In this example the entrypoint is revised to /opt/conda/bin/bakta_db and the list option is passed to the bakta_db command:

docker run --rm --entrypoint='/opt/conda/bin/bakta_db' oschwengers/bakta list

Perform a sequence comparison using legacy BLAST

Download a legacy BLAST Docker image:

docker pull quay.io/biocontainers/blast-legacy:2.2.26--2

Create a container from the image and run formatdb to create a formatted database. In this example the database is created from a DNA sequence file called database.fasta, located in the current directory:

docker run -it --rm -v "$(pwd)":/directory -u "$(id -u)":"$(id -g)" -w /directory quay.io/biocontainers/blast-legacy:2.2.26--2 formatdb -i database.fasta -p F

To perform a blastn search using the formatted database and a query called query.fasta when the file is also located in the current directory:

docker run -it --rm -v "$(pwd)":/directory -u "$(id -u)":"$(id -g)" -w /directory quay.io/biocontainers/blast-legacy:2.2.26--2 blastall -p blastn -d database.fasta -i query.fasta

To perform a blastn search using the formatted database and a query called query.fasta when the query is located in a different directory (in this example your home directory):

docker run -it --rm -v "$(pwd)":/directory/database -v "${HOME}":/directory/query -u "$(id -u)":"$(id -g)" -w /directory quay.io/biocontainers/blast-legacy:2.2.26--2 blastall -p blastn -d database/database.fasta -i query/query.fasta

Set an environment variable inside a Docker container

Use the -e option to set an environment variable. In this example the PATH environment variable is set to /opt/conda/bin/:

docker run --rm -v "$(pwd)":/dir -u "$(id -u)":"$(id -g)" -w /dir -e PATH=/opt/conda/bin/ --entrypoint=/opt/conda/bin/bakta_db oschwengers/bakta download --output my_database --type light

Stop a container

docker container stop some_container

FASTA and FASTQ files

Add a FASTA title to the start of a sequence in RAW format

In this example the title >KL1 is added to the beginning of the sequence in KL1sequence.txt:

perl -pi -e 'print ">KL1\n" if $. == 1' KL1sequence.txt

Combine FASTA files into a single file replacing each FASTA record name with the name of the input file

for file in *.fasta
do
   echo ">$file" >> out.fasta
   tail -n +2 "$file" >> out.fasta
done

Or:

for file in *.fasta
do
   {
     echo ">$file"
     tail -n +2 "$file"
   } >> out.fasta
done

Convert a FASTA file to a CSV file with column names

cat input.fasta | perl -n -0777 -e 'BEGIN{print "SNP_Name,Sequence\n"}' -e 'while ($_ =~ m/^>([^\n]+)\n([^>]+)/gm) {$name = $1; $seq = $2; $seq =~s/\s//g; print $name . "," . $seq . "\n"}' > output.csv

Count reads in compressed FASTQ files using Slurm and parallel

In this example the number of reads in several .fastq.gz files is determined by submitting jobs to Slurm using sbatch. The advantage of this approach is that the counts for each file are generated in parallel, so that results can be obtained more quickly.

The naming scheme of the .fastq.gz files is as follows (the sample name is in the file name, for example ctrl1):

ctrl1_R1.fastq.gz  ctrl2_R2.fastq.gz  trtA1_R1.fastq.gz  trtA2_R2.fastq.gz
ctrl1_R2.fastq.gz  ctrl3_R1.fastq.gz  trtA1_R2.fastq.gz  trtA3_R1.fastq.gz
ctrl2_R1.fastq.gz  ctrl3_R2.fastq.gz  trtA2_R1.fastq.gz  trtA3_R2.fastq.gz

First create an sbatch script called count-reads.sbatch (replace someuser on the second line with your username):

#!/bin/bash
#SBATCH --account=def-someuser
#SBATCH --time=0:30:0
#SBATCH --ntasks=1
#SBATCH --mem=1000M

READS=$(expr $(zcat $1 | wc -l) / 4)
echo "$1 $READS"

The above uses zcat to output the file contents to wc which counts the lines. expr then takes the count from wc and divides by 4 to give the number of sequence reads.

parallel can then be used to apply count-reads.sbatch to each .fastq.gz file. The --dryrun option causes parallel to print out the commands instead of running them. The --delay 1 inserts a one second delay between printing or running jobs. Use the following to print the sbatch commands that will be run later on:

parallel --dryrun --delay 1 -j 1 \
"sbatch -o {1}.out -e {1}.err count-reads.sbatch {1}" ::: *.fastq.gz

The ::: *.fastq.gz leads to one sbatch command being constructed per .fastq.gz file in the current directory.

Each instance of {1} gets replaced with the full name of the .fastq.gz file, such that each input file gets a unique and traceable output filename (so that results aren't overwritten and the relationships among files are clear).

To submit the jobs, run the parallel command again, but without the --dryrun option:

parallel --delay 1 -j 1 \
"sbatch -o {1}.out -e {1}.err count-reads.sbatch {1}" ::: *.fastq.gz

Once the jobs are submitted their statuses can be checked using squeue (replace username with your username):

squeue -u username

Each job creates two output files, for example:

ctrl1_R1.fastq.gz.out
ctrl1_R1.fastq.gz.err

The .out files will contain the name of the input file and the number of reads, for example:

ctrl1_R1.fastq 77283

To quickly check the .err files, which contain any errors or warnings generated by the jobs, use:

cat *.err | more

Once the jobs are complete the output files can be analyzed, e.g.:

cat *R1.fastq.gz.out | sort > R1.reads
cat *R2.fastq.gz.out | sort > R2.reads
paste R1.reads R2.reads

Count the bases in a FASTQ file

zcat < SRR13388732_1.fastq.gz | paste - - - - | cut -f 2 | tr -d '\n' | wc -c

Or:

cat SRR13388732_1.fastq | paste - - - - | cut -f 2 | tr -d '\n' | wc -c

Count the reads in a FASTQ file

file=SRR13388732_1.fastq
READS=$(expr $(cat $file | wc -l) / 4)
echo $READS
file=SRR13388732_1.fastq.gz
READS=$(expr $(zcat < $file | wc -l) / 4)
echo $READS

Download a reference genome FASTA file from Ensembl

To obtain a list of files available for a particular species:

rsync --list-only rsync://ftp.ensembl.org/ensembl/pub/current_fasta/oncorhynchus_mykiss/dna/

To download one of the files:

rsync -av --progress rsync://ftp.ensembl.org/ensembl/pub/current_fasta/oncorhynchus_mykiss/dna/Oncorhynchus_mykiss.USDA_OmykA_1.1.dna.toplevel.fa.gz .

Download FASTQ files based on a list of SRA accessions using Kingfisher

The following example uses Kingfisher, which can download data from the ENA, NCBI, AWS, and GCP.

The accessions are in a file named SRR_Acc_List.txt and are passed to Kingfisher using parallel. The --resume and --joblog options allows the command to be re-run without repeating previously completed jobs.

cat SRR_Acc_List.txt | parallel --resume --joblog log.txt --verbose --progress -j 1 'kingfisher get -r {} -m ena-ascp aws-http prefetch'

Download FASTQ files based on a list of SRA accessions using the SRA Toolkit

The following uses the SRA Toolkit.

Paired-end data:

cat SRR_Acc_List.txt | xargs -I{} fastq-dump -I --split-files --gzip {}

Single-end data:

cat SRR_Acc_List.txt | xargs -I{} fastq-dump --gzip {}

For better performance use fasterq-dump (the following works for single-end and paired-end data):

cat SRR_Acc_List.txt | xargs -I{} fasterq-dump {}
gzip *.fastq

Note that fasterq-dump will generate large cache files in ~/ncbi/public/sra. If this directory does not have sufficient storage create a symbolic link to another directory that does, for example /scratch:

mv ~/ncbi/public/sra /scratch/
ln -s /scratch/sra ~/ncbi/public/sra

SRA Explorer is an online resource that takes a list of accessions and returns a selectable list of ENA download URLs and sequencing run metadata.

Use the NCBI Datasets command-line tools.

The following downloads the mouse reference genome sequence:

datasets download genome taxon mouse --reference --include genome

To download the mouse reference genome and associated amino acid sequences, nucleotide coding sequences, gff3 file, and gtf file:

datasets download genome taxon mouse --reference --include genome,protein,cds,gff3,gtf

For more commands and options see the how-to guides.

Extract FASTA sequences from a file based on a file of sequence names of interest

In this example the sequence names of interest are in the file names.txt and the FASTA sequences are in the file input.fasta:

cat names.txt | xargs -I{} perl -w -076 -e '$count = 0; open(SEQ, "<" . $ARGV[0]); while (<SEQ>) {if ($_ =~ m/\Q$ARGV[1]\E/) {$record = $_; $record =~ s/[\s>]+$//g; print ">$record\n"; $count = $count + 1;}} if ($count == 0) {print STDERR "No matches found for $ARGV[1]\n"} elsif ($count > 1) {print STDERR "Multiple matches found for $ARGV[1]\n"} close(SEQ);' input.fasta {} > output.fasta

Merge compressed FASTQ files

In the following example the sequences folder contains paired-end data, in files like S00EC-0001_S30_1.fastq.gz and S00EC-0001_S30_2.fastq.gz. The goal is to merge all the forward reads into one file and all the reverse reads into another file.

cd sequences
rm -f merged_1.fastq.gz
rm -f merged_2.fastq.gz

find . \( -name "*_1.*" -name "*.fastq.gz" \) -type f \
| while IFS= read -r file1; do

  # forward and reverse filename examples:
  # S00EC-0001_S30_1.fastq.gz
  # S00EC-0001_S30_2.fastq.gz
  # construct name of other file
  file2="${file1/_1./_2.}"

  echo "Processing file '$file1' and '$file2'"

  # check that number of lines match
  lines_R1=$(zcat < "$file1" | wc -l)
  lines_R2=$(zcat < "$file2" | wc -l)

  if [ "$lines_R1" == "$lines_R2" ] ; then
    echo "Both files contain $lines_R1 lines, proceeding with merge"
    cat $file1 >> merged_1.fastq.gz
    cat $file2 >> merged_2.fastq.gz
  else
    echo "WARNING:"
    echo "$file1 contains $lines_R1 lines"
    echo "$file2 contains $lines_R2 lines"
    exit 1
  fi
done

Obtain the flanking sequence of a site of interest from a FASTA file

In this example samtools is used to obtain the upstream and downstream 100 bases of flanking sequence of a SNP at position 42234774 on sequence Y from the FASTA file ARS-UCD1.2_Btau5.0.1Y.fa:

flank=100
pos=42234774
sequence=Y
fasta=ARS-UCD1.2_Btau5.0.1Y.fa
ustart=$(expr $pos - $flank)
uend=$(expr $pos - 1)
dstart=$(expr $pos + 1)
dend=$(expr $pos + $flank)
echo "Upstream flank:" && \
samtools faidx "$fasta" "$sequence":$ustart-$uend | perl -0777 -p -e 's/(?<=[A-Z])\n(?=[A-Z])//gm' && \
echo "SNP site" && \
samtools faidx "$fasta" "$sequence":$pos-$pos | perl -0777 -p -e 's/(?<=[A-Z])\n(?=[A-Z])//gm' && \
echo "Downstream flank:" && \
samtools faidx "$fasta" "$sequence":$dstart-$dend | perl -0777 -p -e 's/(?<=[A-Z])\n(?=[A-Z])//gm'

The perl command is used to remove spaces within the sequence.

Sample output:

Upstream flank:
>Y:42234674-42234773
GGTGTTCAGGTTTGGGAACATGTGTACACCATGGCAGATTCATGTTGATGTATGGCAAAAGCAATACAATATTGTAAAGTAATTAACCTCCAATTAAAAT
SNP site
>Y:42234774-42234774
A
Downstream flank:
>Y:42234775-42234874
AATAAATTTATATTAAAAATGCATCAATTCTTTGGCACTCAGCTTTCTTCACATTCCAATACTCACATCCATACATGACTACTGGAAAATCATAGCCTTG

Process FASTQ files in pairs

High-throughput sequencing data is often distributed as pairs of files corresponding to the two different read sets generated for each sample, e.g.:

6613_S82_L001_R1_001.fastq.gz
6613_S82_L001_R2_001.fastq.gz
70532_S37_L001_R1_001.fastq.gz
70532_S37_L001_R2_001.fastq.gz
k2712_S5_L001_R1_001.fastq.gz
k2712_S5_L001_R2_001.fastq.gz

To analyze data from multiple samples, the following while loop code can be used. It iterates through the R1 files and from each filename constructs the matching R2 filename. Two useful variables called fnx and fn are also created for each file, storing the filename without the path to the file, and the filename without the path and without the file extension, respectively:

find . \( -name "*_R1_*" -name "*.fastq.gz" \) -type f \
| while IFS= read -r file; do
  fnx=$(basename -- "$file")
  fn="${fnx%%.*}"

  # Construct name of other file
  file2="${file/_R1_/_R2_}"
  fnx2=$(basename -- "$file2")
  fn2="${fnx2%%.*}"

  # $file: ./6613_S82_L001_R1_001.fastq.gz
  # $fnx: 6613_S82_L001_R1_001.fastq.gz
  # $fn: 6613_S82_L001_R1_001

  # $file2: ./6613_S82_L001_R2_001.fastq.gz
  # $fnx2: 6613_S82_L001_R2_001.fastq.gz
  # $fn2: 6613_S82_L001_R2_001

  echo "Processing file '$fnx' and '$fnx2'"

  # place commands here that work on file pairs
  lines_R1=$(zcat < "$file" | wc -l)
  lines_R2=$(zcat < "$file2" | wc -l)

  if [ "$lines_R1" == "$lines_R2" ] ; then
    echo "Both files contain $lines_R1 lines"
  else
    echo "WARNING:"
    echo "$fnx contains $lines_R1 lines"
    echo "$fnx2 contains $lines_R2 lines"
  fi
done

Another option is to use parallel.

Process FASTQ files in pairs using parallel

In the following example paired-end reads with names like sampleA_1.fastq.gz and sampleA_2.fastq.gz in a directory called data are mapped to a reference called ref using bowtie2:

parallel -j2 "bowtie2 --threads 4 -x ref -k1 -q -1 {1} -2 {2} -S {1/.}.sam >& {1/.}.log" ::: data/*_1.fastq.gz :::+ data/*_2.fastq.gz

The {1/.} removes the path and the extension from the first filename, leaving the sample name.

Reorder the sequences in a FASTA file based on a VCF file header

Here the VCF used for reordering is input.vcf.gz and the FASTA file to be reordered is reference.fa. The new file is called reference.reordered.fa.

bcftools, tabix and samtools are used:

# create index files for the VCF and FASTA files incase they don't already exist
tabix -p vcf input.vcf.gz
samtools faidx reference.fa

# extract the sequence names from the VCF header
bcftools view -h input.vcf.gz | grep "##contig" > sequence.dict

# reorder the FASTA file
SEQUENCES=$(cat sequence.dict | sed 's/.*ID=//' | sed 's/,.*//')
for SEQ in $SEQUENCES; do
  samtools faidx reference.fa "$SEQ" >> reference.reordered.fa
done

Check the output:

grep ">" reference.reordered.fa

Run FastQC on compressed FASTQ files using Slurm and a job array

An alternative to running the sbatch script for each input file using a loop or parallel is to run it once using the --array=1-N option where you replace N with the number of input files you want to process.

The --array option causes Slurm to create what is called a job array. The advantage of using this approach is that all the jobs are grouped together when viewed using squeue, and job arrays can allow the scheduler to run jobs more efficiently.

When the --array option is used, the contents of the batch script are run once for each input file. Within the batch script the input file is accessed using the variable $SLURM_ARRAY_TASK_ID, which is set by Slurm to the current array index.

This example deals with .fastq.gz files, named as follows (the sample name is in the file name, for example ctrl1):

ctrl1_R1.fastq.gz  ctrl2_R2.fastq.gz  trtA1_R1.fastq.gz  trtA2_R2.fastq.gz
ctrl1_R2.fastq.gz  ctrl3_R1.fastq.gz  trtA1_R2.fastq.gz  trtA3_R1.fastq.gz
ctrl2_R1.fastq.gz  ctrl3_R2.fastq.gz  trtA2_R1.fastq.gz  trtA3_R2.fastq.gz

Here is a batch script called fastqc.sbatch, which is designed to process .fastq.gz files using the fastqc program.

#!/bin/bash
#SBATCH --account=def-someuser
#SBATCH --time=0:30:0
#SBATCH --ntasks=1
#SBATCH --mem=1000M

# Load required modules
module load fastqc

# This is to access the list of R1 files passed as an argument
R1_LIST="$1"

# Get the name of the R1 file to be processed from the list using
# the current array index
# e.g. ctrl1_R1.fastq.gz
R1_FILE="$(sed -n "${SLURM_ARRAY_TASK_ID}p" "$R1_LIST")"

# Construct the name of the R2 file to be processed
# e.g. ctrl1_R2.fastq.gz
R2_FILE="${R1_FILE/_R1/_R2}"

# Remove both extensions and the R1 to get the sample name
# e.g. ctrl1
SAMPLE_NAME="${R1_FILE/_R1.fastq.gz/}"

# Create the output folder for fastqc results for the sample
mkdir -p "fqc_$SAMPLE_NAME"

# Run fastqc on the R1 and R2 files and output to a folder
# named after the sample name
fastqc "$R1_FILE" "$R2_FILE" -o "fqc_$SAMPLE_NAME"

Replace someuser with your username prior to using.

Next, generate a file of the R1 files to be processed and store the length of the list in a variable:

ls *R1.fastq.gz > R1.list
R1_COUNT=$(wc -l R1.list | cut -d' ' -f1)
echo $R1_COUNT

Finally, submit the job array:

sbatch --array=1-$R1_COUNT -o %A-%a.fqc.out -e %A-%a.fqc.err \
fastqc.sbatch R1.list

The --array option is used to specify the range of array indices to be used. In this case the range is 1 to the number of R1 files. These values will be used to set the $SLURM_ARRAY_TASK_ID variable in the batch script and to extract a line (using sed) from the R1.list file.

The -o and -e options are used to specify the files that will receive output and error messages. The %A and %a are replaced by the job array ID (assigned by Slurm) and the array index, respectively. This naming scheme ensures that each job has a unique output and error file.

The R1.list file is passed as an argument to the batch script so that it can be accessed within the script as $1.

To view a list of your submitted jobs (replace username with your username):

squeue -u username

The job array will be listed as a single job, initially with a status of PD (pending). Once the job starts running the status will change to R (running). Once the job array is complete the status will change to CG (completing).

The fastqc results will be written to folders named after the sample names, for example fqc_ctrl1. Output and error messages generated by the script will be written to files with names like 15268018-1.fqc.err and 15268018-1.fqc.out.

The 1 in the file names corresponds to the array index and the 15268018 is the job array ID. You can match up the array index to a specific file by looking at the R1.list file. The first line of R1.list corresponds to array index 1, the second line corresponds to array index 2, etc.

With fastqc, the *.err and *.out files will normally contain progress messages generated by the program when it was running. These files contain what is called "standard error" and "standard output" respectively.

Suppose that a single job didn't complete because not enough time was requested. This can be determined by looking at the *.err file for that job or by an absence of expected output, or by using sacct with the job array ID (which is the prefix of the *.err and *.out files):

sacct -j 15268018 --format=JobID,JobName,State

The above command will show the status of the job array with ID 15268018. State's that indicate a job didn't complete include CANCELLED, FAILED, and TIMEOUT.

The job can be resubmitted using the same command as before, but with a different range of array indices. For example, to resubmit the first job:

sbatch --array=1 --time=1:00:00 \
-o %A-%a.fqc.out -e %A-%a.fqc.err \
fastqc.sbatch R1.list

The --time option is used to specify the new time limit and overrides the value in the script.

To resubmit jobs 3 and 5:

sbatch --array=3,5 --time=1:00:00 \
-o %A-%a.fqc.out -e %A-%a.fqc.err \
fastqc.sbatch R1.list

Split a multi-FASTA file into separate files named according to the sequence title

In this example the sequences are written to a directory called out:

outputdir=out/
mkdir -p "$outputdir"
awk '/^>/ {OUT=substr($0,2); split(OUT, a, " "); sub(/[^A-Za-z_0-9\.\-]/, "", a[1]); OUT = "'"$outputdir"'" a[1] ".fa"}; OUT {print >>OUT; close(OUT)}' input.fasta

File conversion

Convert a website to PDF

The following uses wkhtmltopdf and gs:

url=https://sites.ualberta.ca/~stothard/; depth=1
wget --spider --force-html -r -l${depth} ${url} 2>&1 | grep '^--' | awk '{ print $3 }' | grep -i '\.\(html\|htm\)$' | uniq > url-list.txt
while read i; do wkhtmltopdf "$i" "$(echo "$i" | sed -e 's/https\?:\/\///' -e 's/\//-/g' ).pdf"; done < url-list.txt
gs -dBATCH -dNOPAUSE -q -sDEVICE=pdfwrite -dPDFSETTINGS=/prepress -sOutputFile=merged-output.pdf $(ls -lrt -1 *.pdf)

Convert between audiovisual file formats

See ffmprovisr for commands to modify and covert audiovisual files.

Convert between sequence file formats

There are numerous programs available for this task.

See bio and the example commands.

Some example commands taken from the bio documentation:

# fetch GenBank data
bio fetch NC_045512 MN996532 > genomes.gb

# convert the first ten bases of the genomes to FASTA.
bio fasta genomes.gb --end 10

# align the coding sequences for the S protein
bio fasta genomes.gb --gene S --protein | bio align | head

# print the GFF record that corresponds to the coding sequence for gene S
bio gff genomes.gb --gene S

# show the descendants of taxid 117565
bio taxon 117565 | head

# show the lineage of a taxonomic rank.
bio taxon 117565 --lineage | head

# get metadata on a viral sample
bio meta 11138 -H | head

# define a sequence ontology terms
bio define exon

# define a gene ontology terms
bio define food vacuole

Convert CSV to Excel

The following uses ssconvert, which is distributed with Gnumeric:

ssconvert input.csv output.xlsx

Or use VisiData:

vd input.csv -b -o output.xlsx

Convert CSV to HTML

Use VisiData:

vd input.csv -b -o output.html

Convert CSV to Markdown

The following uses csv2md. The awk command can be used to change missing values to .:

awk 'BEGIN { FS = OFS = "," } { for(i=1; i<=NF; i++) if($i ~ /^ *$/) $i = "." }; 1' input.csv > temp.csv
csv2md -p < temp.csv | sed 's/_/\\_/g' > output.md

Or use VisiData:

vd input.csv -b -o output.md

Convert CSV to TSV

perl -nle  'my @new  = (); push( @new, $+ ) while $_ =~ m{"([^\"\\]*(?:\\.[^\"\\]*)*)",? | ([^,]+),? | ,}gx; push( @new, undef ) if substr( $text, -1, 1 ) eq '\'','\''; for(@new){s/,/ /g} print join "\t", @new' input.csv > output.tab

Or use VisiData:

vd input.csv -b -o output.tab

Convert EPUB to PDF

The following uses calibre:

ebook-convert input.epub output.pdf

Convert DOCX to PDF

The following uses LibreOffice:

soffice --headless --convert-to pdf --outdir . word_file.docx

The following uses pandoc and on macOS also requires basictex:

pandoc word_file.docx --output word_file.pdf

Convert Excel to CSV using csvkit

The following uses csvkit:

in2csv data.xls > data.csv

Or use VisiData. Change Sheet1 in the command below to match the name of the sheet to be converted:

vd input.xls +:Sheet1:1:1 -b -o output.csv

Convert GenBank to FASTA

Use any2fasta:

any2fasta input.gb > output.fa

Convert GenBank to GFF

Install perl-bioperl and then use bp_genbank2gff3:

bp_genbank2gff3 input.gb --outdir output_directory

Convert HTML to PDF

The following uses wkhtmltopdf:

wkhtmltopdf http://google.com google.pdf

Convert HTML to PNG

The following uses wkhtmltoimage:

wkhtmltoimage -f png http://google.com google.png

Another approach, which may work better for complex web sites, is to use pageres-cli. The following creates an image that is 4485 pixels wide (5 * 897):

pageres http://google.com 897x1090 --crop --scale=5 --filename='google'

Convert Markdown to HTML

The command below uses pandoc and the pandoc.css file available here.

pandoc -f markdown -t html -o output.html input.md --css=pandoc.css --self-contained

Convert Markdown to PDF

The command below uses pandoc and the eisvogel.tex template.

The head.tex file consists of the following:

\definecolor{bgcolor}{HTML}{E0E0E0}
\let\oldtexttt\texttt

\renewcommand{\texttt}[1]{
  \colorbox{bgcolor}{\oldtexttt{#1}}
}
pandoc input.md -o output.pdf --pdf-engine=xelatex --from markdown --template=eisvogel.tex --highlight-style zenburn -H head.tex

Convert Markdown to PPTX

The command below uses pandoc. See the pandoc documentation on slide shows.

The --reference-doc parameter is optional and can be used to supply a PowerPoint template.

pandoc input.md -o output.pptx --reference-doc template.potx

Convert PDF to Markdown

Use marker:

python convert_single.py input.pdf output.md

Convert PDF to PNG

The following uses find and the pdftoppm command from the poppler package to generate a PNG image of the first page of every PDF file in the working directory:

find . -name "*.pdf" -exec pdftoppm -f 1 -l 1 -png -r 600 {} {} \;

The -r 600 option sets the resolution to 600 dpi. The -f 1 and -l 1 options specify the first and last pages to convert. The {} is used to specify the input and output file names (they are passed twice to pdftoppm from find). pdftoppm automatically appends the page number to the output file name.

Convert PNG to PDF

The following uses ImageMagick:

convert *.png output.pdf

Convert PPTX to PDF

The following uses LibreOffice:

soffice --headless --convert-to pdf input.pptx

Convert PPTX to PNG

The following uses LibreOffice and ImageMagick to create a separate file for each slide (e.g. slide_1.png, slide_2.png, etc.):

soffice --headless --convert-to pdf input.pptx
convert -density 400 -resize 3000^ -scene 1 input.pdf slide_%d.png

Convert SVG to PNG

The following uses svgexport:

SVGEXPORT_TIMEOUT=60 svgexport input.svg output.png 4000:

The SVGEXPORT_TIMEOUT=60 option sets the timeout to 60 seconds. The 4000: option sets the width to 4000 pixels and the height is automatically calculated to maintain the aspect ratio.

Convert TSV to CSV

awk 'BEGIN { FS="\t"; OFS="," } {
  rebuilt=0
  for(i=1; i<=NF; ++i) {
    if ($i ~ /,/ && $i !~ /^".*"$/) {
      gsub("\"", "\"\"", $i)
      $i = "\"" $i "\""
      rebuilt=1
    }
  }
  if (!rebuilt) { $1=$1 }
  print
}' input.tsv > output.csv

Or use VisiData:

vd input.tsv -b -o output.tab

Convert TSV to Excel

Use VisiData:

vd input.tsv -b -o output.xlsx

File downloads

Download a complete web page as a single HTML file

Use SingleFile or single-file-cli.

The following uses single-file-cli to save https://www.wikipedia.org as wikipedia.html in the current folder:

single-file https://www.wikipedia.org wikipedia.html

Download a GenBank file with bio

See the bio repository and examples.

To download two GenBank files and save as a single file:

bio fetch NC_045512 MN996532 > genomes.gb

Download a GenBank file with curl

The command below downloads a GenBank file from the Nucleotide database at NCBI:

i=NC_045512.2
curl -s  "https://eutils.ncbi.nlm.nih.gov\
/entrez/eutils/efetch.fcgi?db=nucleotide\
&id=${i}&rettype=gbwithparts&retmode=txt" \
> $i.gbk

Download a reference genome GTF file from Ensembl

To obtain a list of files available for a particular species:

rsync --list-only rsync://ftp.ensembl.org/ensembl/pub/current_gtf/oncorhynchus_mykiss/

To download one of the files:

rsync -av --progress rsync://ftp.ensembl.org/ensembl/pub/current_gtf/oncorhynchus_mykiss/Oncorhynchus_mykiss.USDA_OmykA_1.1.106.gtf.gz .

Download an entire website

wget --mirror --convert-links --page-requisites --no-parent https://www.somesite.com/course/material/

Download files from a Globus endpoint using Globus CLI

Note that the destination must be another Globus endpoint.

Install Globus CLI with pip and log into your Globus account

pip install globus-cli
globus login

Access the Globus Web App and note the UUIDs for the source and destination endpoints on the respective overview pages.

To transfer a single file:

globus transfer {source UUID}:/path/to/source/file {dest UUID}:/path/to/dest/file

To transfer all files in a directory:

globus transfer {source UUID}:/path/to/source/dir/ {dest UUID}:/path/to/dest/dir/ --recursive

Download from an FTP server

Replace host, account, password, and port with their corresponding values in the following command:

wget -S -d -c -t 45 -v -r ftp://account:password@host:port/*

Download from Google Drive

Rclone can be used to download data from many cloud storage providers.

First, follow the configuration instructions. The commands below assume that the remote system was named my_google_drive during the configuration.

Note that you can use the Add shortcut to Drive option in Google Drive to make folders and files in Shared with me easier to access using rclone.

To list remote drives:

rclone listremotes

To list directories:

rclone lsd my_google_drive:

To list the contents of a directory

rclone ls my_google_drive:some_directory

To copy the drive to local storage:

rclone copy -P my_google_drive:some_directory ./some_directory

Alternatively, use Transmit or Google Drive for desktop.

Use the NCBI Datasets command-line tools.

The following downloads the mouse reference genome sequence:

datasets download genome taxon mouse --reference --include genome

To download the mouse reference genome and associated amino acid sequences, nucleotide coding sequences, gff3 file, and gtf file:

datasets download genome taxon mouse --reference --include genome,protein,cds,gff3,gtf

For more commands and options see the how-to guides.

Download sequences from the NCBI Assembly database

The commands below download protein sequences derived from Psychrobacter assemblies in the NCBI Assembly database.

esearch, efetch, and xtract can be installed using conda, e.g. conda install -c bioconda entrez-direct.

esearch -db assembly -query '"Psychrobacter"[Organism] AND "latest refseq"[filter]' \
| efetch -format docsum \
| xtract -pattern DocumentSummary -element FtpPath_RefSeq \
| awk -F"/" '{print "curl -o "$NF"_protein.faa.gz " $0"/"$NF"_protein.faa.gz"}' \
| xargs -0 bash -c

Other file types can be downloaded by changing the _protein.faa.gz portions of the awk command. For example, use _genomic.fna.gz to download genomic sequences, or _genomic.gff.gz to download annotations of the genomic sequences in Generic Feature Format Version 3.

The example below is similar but includes the species name in the name of the output files (e.g. Psychrobacter-arcticus_GCF_000012305.1.faa.gz instead of GCF_000012305.1_ASM1230v1_protein.faa.gz):

esearch -db assembly -query '"Psychrobacter"[Organism] AND "latest refseq"[filter]' \
| efetch -format docsum \
| xtract -pattern DocumentSummary -element SpeciesName -element AssemblyAccession -element FtpPath_RefSeq \
| perl -ne 'if (m/([^\t]+)\t([^\t]+)\t([^\t\n]+)/) {$out="$1_$2"; $url=$3; $out=~s/ /-/g; if ($url=~m/([^\/]+)$/) {print "curl -o $out.faa.gz $url/$1_protein.faa.gz\n"}}' \
| xargs -0 bash -c

find

Copy the files returned by find

The following finds files in the directory output ending in .vcf.gz or .vcf.gz.tbi and copies them to the vcfs directory:

mkdir vcfs
find output -type f \( -name "*.vcf.gz" -o -name "*.vcf.gz.tbi" \) -exec cp {} vcfs \;

Copy the files returned by find, naming the copies after a directory in the path

The command below finds files of interest and parses the sample name from a directory name in the path to the file. The sample name is then used to construct a name for the copy.

# Parse the sample name from the path to the file
# Use the sample name to construct the name of the copy
# e.g. ./231_S12_R1_001/star-fusion.fusion_candidates.preliminary is copied to
# ./fusion-candidates/231_S12_R1_001.fusion_candidates.preliminary
find . -name star-fusion.fusion_candidates.preliminary -exec sh -c $'sample=$(perl -e \'if($ARGV[0] =~ m/^\.\/([^\/]+)/){print "$1\n"}\' $1); cp "$1" "./fusion-candidates/${sample}.fusion_candidates.preliminary"' -- {} \;

Determine the total size of certain files using find

The command below reports the total size of files ending with .bam (ignoring case). If more than one invocation of du is required because the file list is very long, multiple totals will be reported and need to be summed.

find . -type f -iname '*.bam' -exec du -ch {} + | grep total$

The following will work on fewer platforms but will provide a single total:

find . -iname '*.bam' -exec du -cb {} + | grep -e "total$" | cut -f1 | paste -sd+ - | bc | numfmt --to=iec --suffix=B --round=towards-zero

Find large files

The following reports the 10 largest files in the current directory or its subdirectories, sorted by size:

find . -type f -print0 | xargs -0 du -h | sort -hr | head -10

Perform a series of commands on files returned by find

The command below finds .gff files and then each file is processed as follows:

  1. tail is used to skip a header line.
  2. awk is used to count the number of occurrences of each category in column 3 and print the category and counts.
  3. sort is used to sort the categories by count from largest to smallest with ties broken by sorting on category name.
  4. The results are redirected to a file named after the input file but with .cog_counts.txt appended.
find . -type f -name "*.gff" -print0 | xargs -0 -I{} sh -c $'tail -n +2 "$1" | awk -F $\'\t\' \'{count[$3]++}END{for(j in count) print j,count[j]}\' | sort -k 2,2nr -k 1,1> "$1.cog_counts.txt"' -- {}

The command below finds .stats files and then each file is processed as follows:

  1. count is used to store the value in a field called number of records , which is obtained using perl .
  2. echo is used to print the filename and count .
  3. perl is used to remove ./ from the filename.
  4. The filenames and counts for all the files are then sorted numerically by the count value, using sort .
  5. awk is used to add a header row and column is used to format the output.
find . -name "*.stats" -exec sh -c $'count=$(perl -0777 -ne \'while (m/number of records:\s+?(\d+)/gm) {$out = $1; $out =~ s/\s//g; print "$out"}\' "$1"); echo "$1 $count" | perl -p -e \'s/\.\///g\'' -- {} \; | sort -k 2,2rn | awk 'BEGIN{print "file variants"}1' | column -t

Often it is simpler to use a loop to iterate through the files returned by find. The following uses awk to filter .maf files:

wd=$(pwd)
find . -name "*.maf" -type f | while IFS= read -r file; do
  dir=$(dirname -- "$file")
  fnx=$(basename -- "$file")
  fn="${fnx%.*}"

  # $file: dir/filename.extension
  # $dir: dir
  # $fnx: filename.extension
  # $fn: filename

  echo "Processing file '$fnx' in directory '$dir'"
  cd "$dir"

  # always print the first two lines
  # print lines where value in column 101 is PASS
  awk -F $'\t' 'NR < 3; NR > 2 {if ($101 == "PASS") print $0}' "$fnx" > "${fn}.new"
  mv "$fnx" "${fnx}.bak"
  mv "${fn}.new" "$fnx"

  cd "$wd"
done

To remove the .bak files:

find . -name "*.bak" -type f -exec rm -rf {} \;

Redirect output to one file

Print the number of lines in every .csv or .tab file in or below current directory and redirect the results to a single file:

find . -type f \( -name "*.csv" -o -name "*.tab" \) | while read f; do wc -l "$f" >> output.txt; done

Or:

find . -type f \( -name "*.csv" -o -name "*.tab" \) -exec wc -l {} \; > output.txt

Or:

find . -type f \( -name "*.csv" -o -name "*.tab" \) -print0 | xargs -0 -I{} wc -l {} > output.txt

Redirect output to separate files

Print the number of lines in every .csv or .tab file in or below current directory and redirect the results to separate files:

find . -type f \( -name "*.csv" -o -name "*.tab" \) | while read f; do wc -l "$f" > "${f}.output.txt"; done

Or:

find . -type f \( -name "*.csv" -o -name "*.tab" \) -exec sh -c 'wc -l "$1" > "$1.output.txt"' -- {} \;

Or:

find . -type f \( -name "*.csv" -o -name "*.tab" \) -print0 | xargs -0 -I{} sh -c 'wc -l "$1" > "$1.output.txt"' -- {}

Remove files using find

The following removes files with a bam extension:

find . -type f -name '*.bam' -exec rm {} \;

Run a command on multiple files at once

Use + instead of \; to run a command on multiple files at once. The following runs cat on all .csv and .tab files in or below the current directory:

find . -type f \( -name "*.csv" -o -name "*.tab" \) -exec cat {} +

Sort files by name before processing

The following used find to generate a list of .vcf.gz files, which is then sorted based on sample number using sort.

The files in this example are named DNA-1.vcf.gz, DNA-2.vcf.gz, etc. and the sort is used to sort based on the number appearing after the first - in the filename.

find . -name "*.vcf.gz" -type f -print0 | sort -z -k2,2n -t- | \
while IFS="" read -r -d "" file; do
  fnx=$(basename -- "$file")
  echo "'$fnx' contains these samples:"
  bcftools query -l $file
done

Sort the files by creation time before processing

Use ls as in the following example:

find . -name "*.png" -type f -exec ls -rt "{}" + | while read file; do
  echo "$file"
done

Switch to the directory containing each file and execute a command

The -execdir option instructs find to switch to the directory containing each matching file before executing the specified command.

In this example the command creates a .zip file for each .vcf file that is found:

find . -name "*.vcf" -type f -execdir zip '{}.zip' '{}' \;

In this example the command reads MD5 sums from MD5.txt files, checks the MD5 sums, and writes the results to a file named checksum-results:

find . -name "MD5.txt" -type f -execdir md5sum --check '{}' \; 2>&1 | tee -a checksum-results

Use files as the argument list for a command

The following finds files ending with .vcf.gz, sorts the files based on the number appearing after the first - in the filename, and prints the filenames separated by spaces by supplying all to echo:

find . -name "*.vcf.gz" -type f -print0 | sort -z -k2,2n -t- | xargs -r0 echo

To print the filenames on separate lines, use:

find . -name "*.vcf.gz" -type f -print0 | sort -z -k2,2n -t- | xargs -r0 -L 1 echo

Git

See GitHub's Git documentation for more information

Add or edit a remote repository

To add a new remote:

git remote add origin <repo-url>

To edit an existing remote:

git remote set-url origin <new-repo-url>

To verify that the remote URL has changed:

git remote -v

Check the status of a working directory

git status

Clone all your repositories

Use the official GitHub CLI tool gh.

Change org_or_username to your username to download all your repositories, or to your organization name to download all the repositories of your organization:

org_or_username=paulstothard

Authenticate with a GitHub host:

gh auth login

Clone up to 1000 repositories under the $org_or_username folder:

gh repo list "$org_or_username" --limit 1000 | while read -r repo _; do
  gh repo clone "$repo" "$repo" -- --recurse-submodules
done

Optionally, to clone new repositories and update existing ones:

gh repo list "$org_or_username" --limit 1000 | while read -r repo _; do
  gh repo clone "$repo" "$repo" -- --recurse-submodules -q 2>/dev/null || (
    cd "$repo"
    git checkout -q main 2>/dev/null || true
    git checkout -q master 2>/dev/null || true
    git pull -q
  )
done

Create a new Git repository

git init

Create and merge Git branches

To view the branches in a repository:

git branch

To create a new branch and switch to it:

git checkout -b <new-branch>

To switch to a remote branch:

git fetch --all
git checkout <remote-branch>

After adding and committing some changes, to push this branch to remote:

git push -u origin <new-branch>

To merge a branch into main (local) and push the changes to remote:

git checkout main
git merge <new-branch>
git push -u origin main

Git merge conflicts can arise easily. For information on resolving a merge conflict, see Resolving a merged conflict using the command line.

List the files being tracked in the repository

The following will list all the files in the main branch:

git ls-tree -r main --name-only

Mark changed files to be included in the next commit

To add one or more files:

git add <filename1> <filename2>

To add all current modifications in your project (including deletions and new files):

git add --all

Move or rename a file or directory

git mv <filename-old> <filename-new>
git commit -m "Move <filename-old> to <filename-new>"

Pull a change from a remote repository to your local branch

git pull <remote> <branch>

For example, to pull from the main branch:

git pull origin main

Push a commit on your local branch to a remote repository

git push <remote> <branch>

For example, to push to the main branch:

git push -u origin main

Remove files from the repository

Note that the following instructions will remove the file/directory from both the working tree and the index.

To remove one or more files:

git rm <filename>
git commit -m "Remove <filename>"

To remove a directory:

git rm -r <directory>
git commit -m "Remove <directory>"

To remove a file from the index (this untracks the file, it does not delete the file itself):

git rm --cached <filename>
git commit -m "Remove <filename>"

Save the marked files to the local Git repository

The commit should include a message using the -m option:

git commit -m "A concise description of the changes, e.g. 'Add tests for input file parsing'"

The following changes can be made to commits that have not been pushed to a remote repository. To rewrite the very last commit, with any currently staged changes:

git commit --amend -m "An updated message"

To commit any currently staged changes without rewriting the commit (this essentially adds the staged changes to the previous commit):

git commit --amend --no-edit

Specify files to ignore

Create a .gitignore file:

touch .gitignore

Add text or patterns to exclude:

echo sensitive_data.txt >> .gitignore
echo test/*.vcf >> .gitignore
git add .gitignore
git commit -m "add .gitignore file"
git push -u origin main

In this example, the following files will no longer be tracked: sensitive_data.txt, and all files with a .vcf extension in the directory test.

Note that adding a .gitignore file will not remove tracked files; this must be done with git rm. See Remove files from the repository.

Sync a repository to your local machine

First, copy the clone URL on the GitHub repository page by clicking Clone or Download. Then, enter the following command in a terminal window. The helpful_commands repository is used as an example:

git clone https://github.com/stothard-group/helpful_commands.git

Tag a release

A tag allows a specific release version of code to be identified, and creates a release that can be downloaded from GitHub. A tagged version serves as a snapshot that does not change.

git tag -a v2.0.0 -m "version 2.0.0"
git push origin v2.0.0

Information on how to choose version numbers if available here.

Undo a Git add before a commit

To undo a list of files:

git reset <filename1>

To undo all changes:

git reset

View the changes you haven't staged for commit

git diff

View the commit history

You can see past changes, including who made them and when:

git log

View the commit history with a list of the files that were changed:

git log --stat

View the commit history along with the actual changes (patches) made in each commit:

git log -p

View the status of files in your working directory

git status lets you see which changes have been staged, which haven't, and which files aren't being tracked by Git.

git status

grep

Count matches

In this example the number of lines with a match to > is returned:

grep -c ">" input.fasta

Get the line number of a match

In this example the line numbers of lines with a match to 234829 are reported:

grep -n "234829" input.txt

Keep everything except lines starting with #:

grep -v '^#' input.txt

Remove files that contain a match

In this example .fasta files are removed that contain the text complete genome on a single line:

grep -l "complete genome" *.fasta | xargs -I{} rm -f {}

Remove files that do not contain a match

In this example .fasta files are removed that do not contain the text complete genome on a single line:

grep -L "complete genome" *.fasta | xargs -I{} rm -f {}

Search using patterns from a file

This example uses patterns from the text file ensembl_ids.txt, which contains one gene ID per line:

ENSCAFG00000018897
ENSCAFG00000006950
ENSCAFG00000013069
ENSCAFG00000013670
ENSCAFG00000003247

The first grep command is used to add the VCF header to the output file:

grep '^#' annotated_variants.vcf > annotated_variants.candidates.vcf
grep -f ensembl_ids.txt annotated_variants.vcf >> annotated_variants.candidates.vcf

Image files

Create an animated GIF from a YouTube video

The following requires yt-dlp, mplayer, ImageMagick, and gifsicle:

mkdir gif; cd gif
url=https://youtu.be/_YUAu0aP4DA
start=00:37; length=10
yt-dlp -f mp4 -o video_for_gif.mp4 $url
mplayer video_for_gif.mp4 -ao null -ss $start -endpos $length -vo png -vf scale=400:225
mogrify -format gif *.png
gifsicle --threads=2 --colors=256 --delay=4 --loopcount=0 --dither -O3 *.gif > animation.gif

Crop an image and add a white border

The following uses ImageMagick to removes any edges that are exactly the same color as the corner pixels. A 30-pixel white border is then added to the sides and the top and bottom:

convert input.png -trim -bordercolor White -border 30x30 output.png

Record your screen to an animated GIF

Use LICEcap.

Record your terminal to an animated GIF

Use Terminalizer to record a session. The following creates a file called session.yml:

terminalizer record session

To convert the session to an animated GIF:

terminalizer render session

For more control over rendering options create an editable configuration file at ~/.terminalizer/config.yml:

terminalizer init

Resize an image

The following uses ImageMagick to scale the image so that its width is 4000 pixels:

convert input.png -resize 4000 output.png

Take a screenshot of a window on macOS

  1. Press Command+Shift+4 .
  2. Press the space bar .
  3. Hold Option and click on the window.

To keep the drop shadow perform the last step without holding Option.

To copy the screenshot to the clipboard instead of saving it to a file, use Command+Control+Shift+4.

Take a webpage screenshot using Firefox

  1. Press F12 to open the Firefox Developer Tools.
  2. Enter :screenshot into the Web Console to download the current view as a PNG file.

To save a high-DPI webpage screenshot use :screenshot --dpr 4.

To save a high-DPI full-page webpage screenshot use :screenshot --dpr 4 --fullpage.

To delay the screenshot, to capture a menu for example, use :screenshot --dpr 4 --fullpage --delay 5.

To copy the screenshot to the clipboard instead of saving it to a file, use :screenshot --clipboard.

join

Combine rows and print a subset of columns using join

The following combines rows from two files based on shared identifiers and prints select columns from each file (using the -o option). awk is used to add column names to the output file:

join -t, -1 1 -2 1 -o 2.2,1.2,2.2,1.4,1.5,1.6 <(sort -t, -k1 file1.csv) <(sort -t, -k1 file2.csv) | awk -F, 'BEGIN{print "patient,status,sample,lane,fastq_1,fastq_2"}{print}' OFS=, > final_samplesheet.csv

Combine rows based on shared keys with join

join is used to join lines from different files when they have matching join fields. join expects the input files to be sorted.

Suppose file1.txt contains the following text:

name,counts in sample 1
gene a,100
gene b,2223
gene e,575

Suppose file2.txt contains this text:

counts in sample 2,name
2223,gene e
803,gene a
0,gene f

To join their contents based on name, first sort the files based on the name column (note that the sort field differs between the two commands):

(head -n 1 file1.txt && sort -t, -k 1 <(tail -n +2 file1.txt)) > file1.txt.sorted
(head -n 1 file2.txt && sort -t, -k 2 <(tail -n +2 file2.txt)) > file2.txt.sorted

Then use the join command to combine the rows based on field 1 in the first file and field 2 in the second file:

join -t, -1 1 -2 2 file1.txt.sorted file2.txt.sorted

The above command returns the following:

name,counts in sample 1,counts in sample 2
gene a,100,803
gene e,575,2223

To format more nicely use:

join -t, -1 1 -2 2 file1.txt.sorted file2.txt.sorted | column -t -s,

Which gives:

name    counts in sample 1  counts in sample 2
gene a  100                 803
gene e  575                 2223

To include genes present in just one of the files and to add a missing value character . for the corresponding values that could not be obtained use:

join -t, -1 1 -2 2 -a1 -a2 -e . -o auto file1.txt.sorted file2.txt.sorted | column -t -s,

Which gives:

name    counts in sample 1  counts in sample 2
gene a  100                 803
gene b  2223                .
gene e  575                 2223
gene f  .                   0

Another option is to use csvjoin from csvkit.

Jupyter

Use a local Conda environment as a Python kernel

Create the Conda environment and add it as a kernel to Jupyter (run the following commands in the terminal):

# Create a new Conda environment, changing the name as needed
NEW_ENV_NAME=plot-python
PYTHON_VERSION=3.12
mamba create -y --name "$NEW_ENV_NAME" python=$PYTHON_VERSION
mamba activate "$NEW_ENV_NAME"
# Use the next command if using Apple silicon and osx-arm64 packages aren't available
conda config --env --set subdir osx-64
# Install the jupyter and ipykernel packages
mamba install -y -c conda-forge jupyter ipykernel
# Install the desired packages, e.g.
mamba install -y -c conda-forge -c bioconda numpy pandas matplotlib seaborn scikit-learn
# Add the Python kernel to Jupyter
python -m ipykernel install --user --name "$NEW_ENV_NAME" --display-name="Python ($NEW_ENV_NAME)"
# Deactivate the Conda environment
mamba deactivate

Restart VS Code or Jupyter Notebook and open a notebook and select the Jupyter kernel that you created.

Use a remote Conda environment as a Python kernel

On the remote system create the Conda environment and add it as a kernel to Jupyter (run the following commands in the terminal on the remote system):

# Create a new Conda environment, changing the name as needed
NEW_ENV_NAME=plot-python
PYTHON_VERSION=3.12
mamba create -y --name "$NEW_ENV_NAME" python=$PYTHON_VERSION
mamba activate "$NEW_ENV_NAME"
# Use the next command if using Apple silicon and osx-arm64 packages aren't available
conda config --env --set subdir osx-64
# Install the jupyter and ipykernel packages
mamba install -y -c conda-forge jupyter ipykernel
# Install the desired packages, e.g.
mamba install -y -c conda-forge -c bioconda numpy pandas matplotlib seaborn scikit-learn
# Add the Python kernel to Jupyter
python -m ipykernel install --user --name "$NEW_ENV_NAME" --display-name="Python ($NEW_ENV_NAME)"
# Deactivate the Conda environment
mamba deactivate

On the remote system launch tmux, activate the environment, and start Jupyter:

tmux new -s jupyter
NEW_ENV_NAME=plot-python
mamba activate "$NEW_ENV_NAME"
jupyter notebook --no-browser --port=8888

Note the token that is displayed in the output of the jupyter notebook command.

For example:

399401bd7d1259c4f7d51bd005602f30a0c28e184bf3313e

Now disconnect from the tmux session by pressing Ctrl-b then d.

On the local system, create an SSH tunnel to the remote system (gentec is an entry in the SSH configuration file, ~/.ssh/config; change the name as needed, for example to user@host):

ssh -L 8888:localhost:8888 gentec

The above will forward port 8888 on the remote machine to port 8888 on the local machine. Leave this terminal open.

Open a Jupyter Notebook in a VS Code and click Select Kernel and then Existing Jupyter Server. Enter the following URL (appending the token from the remote system):

http://localhost:8888/?token=399401bd7d1259c4f7d51bd005602f30a0c28e184bf3313e

Then choose the kernel that you created, from the available kernels.

To end the session, close the Jupyter Notebook and the terminal running the SSH tunnel. Connect to the server and stop the Jupyter Notebook server by pressing Ctrl-c in the terminal where the server is running (use tmux a -t jupyter to attach to the session). Then close the tmux session by running exit in the tmux session.

Use a Python virtual environment as a Python kernel

Create a Python virtual environment and add it as a kernel to Jupyter (run the following commands in the terminal, in the project root directory):

# Create a new Python virtual environment, changing the name as needed
NEW_ENV_NAME=plot-venv
PYTHON_VERSION=python3.12
echo "${NEW_ENV_NAME}/" >> .gitignore
$PYTHON_VERSION -m venv "$NEW_ENV_NAME"
source "${NEW_ENV_NAME}/bin/activate"
# Install the desired packages, e.g.
pip install numpy pandas matplotlib seaborn scikit-learn
# Install the jupyter and ipykernel packages
pip install jupyter ipykernel
# Add the virtual environment kernel to Jupyter
python -m ipykernel install --user --name "$NEW_ENV_NAME" --display-name="Python ($NEW_ENV_NAME)"
# Deactivate the virtual environment
deactivate

Restart VS Code or Jupyter Notebook and open a notebook and select the Jupyter kernel that you created.

Use a Python virtual environment created using venv_wrapper

The venv_wrapper script simplifies the creation of Python virtual environments. It is in my dotfiles and is based on this script.

Create a Python virtual environment and add it as a kernel to Jupyter (run the following commands in the terminal, in the project root directory):

# Create a new Python virtual environment, changing the name and Python version as needed
NEW_ENV_NAME=plot-venv
PYTHON_VERSION=3.12
echo "$HOME/.venv/${NEW_ENV_NAME}/" >> .gitignore
# Create and activate the new virtual environment using the wrapper commands
mkvenv "$NEW_ENV_NAME" "$PYTHON_VERSION"
# Install the desired packages, e.g.
pip install numpy pandas matplotlib seaborn scikit-learn
# Install the jupyter and ipykernel packages
pip install jupyter ipykernel
# Add the virtual environment kernel to Jupyter
python -m ipykernel install --user --name "$NEW_ENV_NAME" --display-name="Python ($NEW_ENV_NAME)"
# Deactivate the virtual environment
deactivate

Restart VS Code or Jupyter Notebook and open a notebook and select the Jupyter kernel that you created.

Use a local Conda environment as a Bash kernel

Create the Conda environment and add it as a kernel to Jupyter (run the following commands in the terminal):

# Create a new Conda environment, changing the name as needed
NEW_ENV_NAME=vep-bash
PYTHON_VERSION=3.12
mamba create -y --name "$NEW_ENV_NAME" python=$PYTHON_VERSION
mamba activate "$NEW_ENV_NAME"
# Use the next command if using Apple silicon and osx-arm64 packages aren't available
conda config --env --set subdir osx-64
# Install the desired packages, e.g.
mamba install -y -c conda-forge -c bioconda ensembl-vep
# Install the jupyter and bash_kernel packages
mamba install -y -c conda-forge jupyter bash_kernel
# Install the Bash kernel within the environment
python -m bash_kernel.install
# Deactivate the Conda environment
mamba deactivate

Restart VS Code or Jupyter Notebook and open a notebook and select the Jupyter kernel that you created.

Use a remote Conda environment as a Bash kernel

On the remote system create the Conda environment and add it as a kernel to Jupyter (run the following commands in the terminal on the remote system):

# Create a new Conda environment, changing the name as needed
NEW_ENV_NAME=vep-bash
PYTHON_VERSION=3.12
mamba create -y --name "$NEW_ENV_NAME" python=$PYTHON_VERSION
mamba activate "$NEW_ENV_NAME"
# Use the next command if using Apple silicon and osx-arm64 packages aren't available
conda config --env --set subdir osx-64
# Install the desired packages, e.g.
mamba install -y -c conda-forge -c bioconda ensembl-vep
# Install the jupyter and bash_kernel packages
mamba install -y -c conda-forge jupyter bash_kernel
# Install the Bash kernel within the environment
python -m bash_kernel.install
# Deactivate the Conda environment
mamba deactivate

On the remote system launch tmux, activate the environment, and start Jupyter:

tmux new -s jupyter
NEW_ENV_NAME=vep-bash
mamba activate "$NEW_ENV_NAME"
jupyter notebook --no-browser --port=8888

Note the token that is displayed in the output of the jupyter notebook command.

For example:

399401bd7d1259c4f7d51bd005602f30a0c28e184bf3313e

Now disconnect from the tmux session by pressing Ctrl-b then d.

On the local system, create an SSH tunnel to the remote system (gentec is an entry in the SSH configuration file, ~/.ssh/config; change the name as needed, for example to user@host):

ssh -L 8888:localhost:8888 gentec

The above will forward port 8888 on the remote machine to port 8888 on the local machine. Leave this terminal open.

Open a Jupyter Notebook in a VS Code and click Select Kernel and then Existing Jupyter Server. Enter the following URL (appending the token from the remote system):

http://localhost:8888/?token=399401bd7d1259c4f7d51bd005602f30a0c28e184bf3313e

Then choose the kernel that you created, from the available kernels.

To end the session, close the Jupyter Notebook and the terminal running the SSH tunnel. Connect to the server and stop the Jupyter Notebook server by pressing Ctrl-c in the terminal where the server is running (use tmux a -t jupyter to attach to the session). Then close the tmux session by running exit in the tmux session.

Mamba

Mamba is a reimplementation of the conda package manager in C++.

Activate an environment with mamba

mamba activate ngs

Add additional packages to an environment with mamba

mamba activate ngs
mamba install -y -c bioconda -c conda-forge picard

Create an environment and install some packages with mamba

In this example an environment called ngs is created:

mamba create -y --name ngs
mamba activate ngs
mamba install -y -c bioconda -c conda-forge multiqc fastqc trimmomatic bowtie2 subread samtools

Create an environment from a yaml file with mamba

mamba env create --file env-environment.yaml

Deactivate an environment with mamba

mamba deactivate

Export an environment to a yaml file with mamba

Use the export command while the environment is active:

mamba env export > env-environment.yaml

Install Mamba

conda install mamba -n base -c conda-forge

To install Conda with included support for Mamba, use Miniforge.

List available packages with mamba

mamba search -c bioconda -c conda-forge

List environments with mamba

mamba env list

List packages installed in the active environment with mamba

mamba list

Remove an environment with mamba

In this example the environment to remove is called my-env:

mamba deactivate
mamba env remove --name my-env

Search for a specific package with mamba

mamba search -c bioconda -c conda-forge blast

Create a mamba environment on Apple silicon when packages are not available

If packages are not available for osx-arm64 use conda config --env --set subdir osx-64. For example:

mamba create -y --name vcf
mamba activate vcf
conda config --env --set subdir osx-64
mamba install -y -c conda-forge -c bioconda bcftools vcftools tabix

Register a mamba environment with Jupyter as a Bash kernel

mamba create -y --name sv-bash
mamba activate sv-bash
# Use conda 'config --env --set subdir osx-64' on macOS if packages are not available for osx-arm64
conda config --env --set subdir osx-64
mamba install -y -c conda-forge -c bioconda jupyter bash_kernel bcftools vcftools tabix
python -m bash_kernel.install

Register a mamba environment with Jupyter as a Python kernel

mamba create -y --name sv-python
mamba activate sv-python
mamba install Jupyter
mamba install ipykernel
python -m ipykernel install --user --name sv-python_env --display-name "Python (sv-python_env)"

md5sum

Generate a file of checksums

md5sum *.vcf.gz > md5sum.txt

Validate checksums

md5sum --check md5sum.txt

Miller

Miller can be used to work with CSV, TSV, and JSON files.

Combine actions

Perform multiple actions sequentially using then:

mlr --csv put '$New_coverage = ($Coverage / 100)' then sort -f Breed -nr Coverage then cut -f InterbullID,New_coverage example.csv

Convert formats

From CSV to JSON:

mlr --icsv --ojson cat example.csv

From CSV to TSV:

mlr --icsv --otsv cat example.csv

Edit columns

To view the put documentation:

mlr put --help

The following converts Breed to uppercase and divides Coverage by 100:

mlr --csv put '$Breed = toupper($Breed); $Coverage = ($Coverage / 100)' example.csv

New columns can be created:

mlr --csv put '$New_coverage = ($Coverage / 100)' example.csv

Extract columns

To view the cut documentation:

mlr cut --help

The following extracts the Breed and Coverage columns:

mlr --csv cut -f Breed,Coverage example.csv

Extract the first 10 records of a CSV file

Print the column names followed by the records:

mlr --csv head -n 10 example.csv

Print with added formatting for readability:

mlr --icsv --opprint head -n 10 example.csv

Print each value with the column name in the form column=value:

mlr --icsv --odkvp head -n 10 example.csv

Extract the last 10 records of a CSV file

Print the column names followed by the records:

mlr --csv tail -n 10 example.csv

Print with added formatting for readability:

mlr --icsv --opprint tail -n 10 example.csv

Print each field with the column name in the form column=field:

mlr --icsv --odkvp tail -n 10 example.csv

Filter records

To view the filter documentation:

mlr filter --help

The following filters records based on Breed, Dataset, and Coverage:

mlr --csv filter '$Breed == "Charolais" && $Dataset == "A" && $Coverage > 6' example.csv

Other actions

To view a complete list of Miller verbs use the following:

mlr -l

To view documentation for a particular verb use mlr _verb_ --help.

Sort records

To view the sort documentation:

mlr sort --help

The following first sorts alphabetically by Breed and then numerically by Coverage (from largest to smallest):

mlr --icsv --opprint sort -f Breed -nr Coverage example.csv

View stats

To view the stats1 and stats2 documentation:

mlr stats1 --help
mlr stats2 --help

To view several stats for the Coverage column:

mlr --icsv --opprint stats1 -a sum,count,min,max,mean,mode -f Coverage example.csv

Other

Add a header to all files with a certain extension, getting the header from another file

In this example the header is added to .tab files and comes from a file called header.txt. The files with the header added are saved with a .new extension added:

for f in *.tab; do new=`echo $f | sed 's/\(.*\)\.tab/\1.tab.new/'`; paste -sd'\n' \header.txt "$f" > "$new"; done

To replace the .tab files the .new files:

for f in *.new; do new=`echo $f | sed 's/\(.*\)\.new/\1/'`; mv "$f" "$new"; done

Add text or a header to the beginning of all files with a particular file extension

Add my header text to the start of all .csv files in the current directory (works on macOS):

find . -name "*.csv" -exec sed -i '.bak' '1s/^/my header text\'$'\n/g' {} \;

Add my header text to the start of all .csv files in the current directory (works on Linux):

find . -name "*.csv" -exec sed -i '1s/^/my header text\n/' {} \;

Add text to the beginning of a file

echo 'new header line' | cat - file.txt > temp && mv temp file.txt

Browse, search, and edit a large CSV file

Use DB Browser for SQLite (DB4S).

Calculate coverage statistics for a BAM file

Use mosdepth. The following generates a variety of useful output files prefixed with 20079:

mosdepth 20079 20079.markdup.sorted.bam

Change the extension of multiple files

The following changes the .gbff extension to .gbk:

for f in *.gbff; do
    mv -- "$f" "${f%.gbff}.gbk"
done

If rename is available, this may work:

rename 's/\.gbff$/.gbk/' *.gbff

Or this, depending on which rename is installed:

rename .gbff .gbk *.gbff

Copy an ssh public key to another system

Generate the key pair:

ssh-keygen

Copy the public key to the .ssh/authorized_keys file on the other system using ssh-copy-id:

ssh-copy-id -i ~/.ssh/id_rsa.pub user@remote-host.com

Create a collection of MP3 files from a YouTube playlist

The following requires yt-dlp and ffmpeg:

playlist_URL=https://www.youtube.com/playlist?list=PL92319EECC1754042
yt-dlp -x -i --audio-format mp3 --audio-quality 320K --embed-thumbnail --geo-bypass --rm-cache-dir --continue "$playlist_URL"

Edit a PDF file

Use LibreOffice.

Find common lines between files

Between two files, named file1.txt and file2.txt:

comm -12 <( sort file1.txt ) <( sort file2.txt )

Among all .txt files in the current directory:

number_of_files=$(find . -name "*.txt" -print | wc -l | sed 's/[^0-9]*//g')
cat *.txt | sort | uniq -c | sed -n -e "s/^ *$number_of_files \(.*\)/\1/p"

Format a CSV file into columns and examine its content

The perl portion is used to handle empty fields:

cat data.csv | perl -pe 's/((?<=,)|(?<=^)),/ ,/g;' | column -t -s, | less -S

Format code

The Prettier program supports many languages. The following command uses the --write option to reformat files in-place:

prettier --write "*html"

Obtain your public IP address and network information

curl ifconfig.me/all

Perform a calculation using bc

echo "2*(42+42)" | bc

Perform a calculation using expr

expr 6 + 2 \* 5

The following uses BLAST+ to compare a protein sequence query against the nr database:

in=ILFGCMKP_01075.faa
out=ILFGCMKP_01075_nr.tab
blastp -query "$in" -remote -db nr -out "$out" -outfmt '7 qseqid stitle sstart send qcovs qcovhsp pident evalue' -evalue 1e-10

In this example, remote BLAST is used to examine the taxonomy of contigs:

# First, create the taxonomy database that will be used by BLAST:
mkdir -p taxonomy_database
wget ftp://ftp.ncbi.nlm.nih.gov/blast/db/taxdb.tar.gz
mv taxdb.tar.gz taxonomy_database
tar -xvzf taxonomy_database/taxdb.tar.gz -C taxonomy_database
export BLASTDB=/home/paul/taxonomy_database

# Perform the BLAST search:
mkdir -p blast_output
blastn -query contigs.fa \
-db nr -out blast_output/contigs.out \
-max_target_seqs 5 -outfmt "6 qseqid sseqid sscinames scomnames pident evalue" -remote

Large contigs may exceed the maximum query length for remote BLAST searches. The following script can be used to extract the first 1000 bp from each contig:

import argparse
from Bio import SeqIO

def trim_contigs(input_file, output_file, min_length=1000):
    with open(output_file, 'w') as out_f:
        for record in SeqIO.parse(input_file, 'fasta'):
            if len(record.seq) >= min_length:
                trimmed_record = record[:min_length]  # Get the first 1000 bases
                SeqIO.write(trimmed_record, out_f, 'fasta')

def main():
    parser = argparse.ArgumentParser(description="Trim DNA contigs to the first 1000 bases if they are at least 1000 bases long.")
    parser.add_argument("-i", "--input", required=True, help="Input FASTA file containing DNA contigs.")
    parser.add_argument("-o", "--output", required=True, help="Output FASTA file to store trimmed contigs.")
    args = parser.parse_args()

    trim_contigs(args.input, args.output)

if __name__ == "__main__":
    main()

To use the script, save it as trim_contigs.py and run it as follows (you may need to install the Biopython package first using pip install biopython):

python trim_contigs.py -i contigs.fa -o contigs_trimmed.fa

Then use the trimmed contigs as the query in the BLAST search:

blastn -query contigs_trimmed.fa \
-db nr -out blast_output/contigs_trimmed.out \
-max_target_seqs 5 -outfmt "6 qseqid sseqid sscinames scomnames pident evalue" -remote

Perform a calculation using qalc

qalc is a calculator with support for units. The following uses qalc to convert 1.5 hours to minutes:

qalc "1.5 hours to minutes"

See the qalc documentation for more examples.

Prevent a command from stopping when you log out or exit the shell

Use nohup:

nohup mycommand &

When using & the bash job ID is shown in brackets and the PID (process ID), e.g.:

[1] 1963

The output of the command can be found in nohup.out.

The command can be stopped using kill and the PID, e.g.:

kill -9 1963

Remove duplicate files

Use fdupes to find and remove duplicate files.

The following command finds duplicate files in the current directory and its subdirectories:

fdupes -r /path/to/directory

Use the -d option to delete duplicates (you will be prompted to confirm each deletion):

fdupes -d -r /path/to/directory

To delete duplicates without being prompted, use the -N option:

fdupes -dN -r /path/to/directory

Reverse the order of lines in a file

tail -r input.txt > output.txt

Or:

tac input.txt > output.txt

Run commands at scheduled times using cron

The following uses cron to run a script to copy various files and directories to a directory backed up by Dropbox.

Create the script the copy_to_dropbox.sh script, editing as needed:

#!/bin/bash

PATH=/bin:/usr/bin/

home=/Users/myhome

target=${home}/Dropbox/backup

if [[ ! -e $target ]]; then
    mkdir -p $target
elif [[ ! -d $target ]]; then
    echo "$target already exists but is not a directory" 1>&2
fi

#copy files and directories of interest to $target
rsync --update -razv ${home}/.bash_profile $target/bash_profile
rsync --update -razv ${home}/lib $target
rsync --update -razv ${home}/bin $target

Test the script as follows:

chmod u+x copy_to_dropbox.sh
sudo env -i ./copy_to_dropbox.sh

Use crontab -e to edit the crontab (cron table) file. Add the following to the crontab to run the script everyday at noon (changing the path to copy_to_dropbox.sh):

0 12 * * * /path/to/copy_to_dropbox.sh >/dev/null 2>&1

Alternatively, use the following to run the script once per hour between 8 am and 5 pm on weekdays:

0 8-17 * * 1-5 /path/to/copy_to_dropbox.sh >/dev/null 2>&1

To display the crontab use crontab -l.

Use MMseqs2 for bacterial contig taxonomic assignment

The following uses MMseqs2 and the GTDB database to classify bacterial contigs:

# Pull the MMseqs2 Docker image
docker pull ghcr.io/soedinglab/mmseqs2

# Download and prepare the GTDB database
mkdir -p db
docker run --rm -v "$(pwd)":/dir -u "$(id -u)":"$(id -g)" -w /dir \
ghcr.io/soedinglab/mmseqs2 databases GTDB db/gtdb /tmp

# Analyze the contigs
mkdir -p mmseqs2_output/gtdb
docker run --rm -v "$(pwd)":/dir -u "$(id -u)":"$(id -g)" -w /dir \
ghcr.io/soedinglab/mmseqs2 easy-taxonomy contigs.fa db/gtdb mmseqs2_output/gtdb/contigs /tmp --lca-mode 4

Use SQL-like queries to work with a CSV or TSV file

The following uses q to count distinct values in the column named SNP:

q -H -d, "SELECT COUNT(DISTINCT(SNP)) FROM ./input.csv"

Another option is to use csvsql from csvkit.

parallel

Compress files in parallel

In the following example 5 jobs are run at the same time:

parallel -j5 "gzip {}" ::: *.csv

Download sequence files and resume without repeating completed jobs using parallel

The following example uses Kingfisher, which can download data from the ENA, NCBI, AWS, and GCP.

The accessions are in a file named SRR_Acc_List.txt and are passed to Kingfisher using parallel. The --resume and --joblog options allows the command to be re-run without repeating previously completed jobs.

cat SRR_Acc_List.txt | parallel --resume --joblog log.txt --verbose --progress -j 1 'kingfisher get -r {} -m ena-ascp aws-http prefetch'

Extract files in parallel

In the following command {.} is used to get the basename and remove the last extension of each input file:

parallel 'zcat < {} > {.}.unpacked' ::: *.gz

Or:

parallel 'gunzip {}' ::: *.gz

Perform a separate BLAST search for each query and database using parallel

In the following example there are protein sequence files ending with .faa in a directory called queries and BLAST databases ending with .faa in a directory called databases.

The parallel command with --dryrun is used to display the blastp commands that will be run. The second parallel command executes the commands.

The output from each BLAST search is written to a directory called output and is named after the query and database files (the {1/.} and {2/.} remove the path and extension from the query and database filenames, respectively, when constructing the output filename).

querydir=queries
databasedir=databases
outdir=output
mkdir "$outdir"
parallel --dryrun -j 1 "blastp -evalue 0.0001 -query {1} -db {2} -out $outdir/{1/.}_{2/.}.tab" ::: "$querydir"/*.faa ::: "$databasedir"/*.faa
parallel --verbose -j 1 "blastp -evalue 0.0001 -query {1} -db {2} -out $outdir/{1/.}_{2/.}.tab" ::: "$querydir"/*.faa ::: "$databasedir"/*.faa

Perform BLAST in parallel

Using the local system:

cat multiple_sequences.fasta | parallel --block 100k --recstart '>' --pipe blastp -evalue 0.01 -outfmt 6 -db database.fa -query - > results

Using the local system (denoted as : below) and a remote system called server1 (connection details provided in .ssh/config):

cat multiple_sequences.fasta | parallel -S :,server1 --block 100k --recstart '>' --pipe blastp -evalue 0.01 -outfmt 6 -db database.fa -query - > results

Read parameters from a file using parallel

In this example each line of queries.csv consists of a gene name followed by a protein accession number, e.g. narG,NP_415742.1. The accession is used to download a protein sequence, which is written to a file named after the gene name.

cat queries.csv | parallel -k -j 1 --colsep ',' 'esearch -db protein -query "{2}[ACCESSION]" | efetch -format fasta > "{1}.faa"'

paste

Combine columns with paste

In this example the columns of two files are joined. The first file is a CSV file the second is tab-delimited.

The -d "," specifies that the lines are to be joined with commas.

paste -d "," genotype_conversion.csv SNP_Map.tab

Note that the content from SNP_Map.tab still contains tab-delimited values.

To remove tabs from SNP_Map.tab you could first create a CSV version of that input file:

cut -d $'\t' -f 1- --output-delimiter=',' SNP_Map.tab > SNP_Map.csv
paste -d "," genotype_conversion.csv SNP_Map.csv

It is possible to do it without first creating SNP_Map.csv by using process substitution.

In the following the command between <( and ) is first run and its output becomes input for paste:

paste -d "," genotype_conversion.csv \
<(cut -d $'\t' -f 1- --output-delimiter=',' SNP_Map.tab)

Perl

Count the number of lines that match a regular expression

perl -lne '$a++ if /\tyes\t/; END {print $a+0}' < input.txt

Format Perl code

The following uses perltidy to reformat the code in testfile.pl and will create a file called testfile.pl.tdy.

perltidy testfile.pl

Get a random sample of lines from a text file while excluding the header line

In this example a random sample of 20 lines is obtained:

tail -n +2 input.txt | perl -MList::Util -e 'print List::Util::shuffle <>' | head -n 20 > output.txt
perl -ne '/ENSBTAG00000028061/ && print' input.txt
perl -0777 -ne 'while (m/^\s+\/translation="([^"]+)"/gm) {$out = $1; $out =~ s/\s//g; print "$out\n"}' NM_001271626.3.gbk
perl -0777 -ne 'while (m/^\s+\/translation="([^"]+)"/gm) {print "$1\n"}' NM_001271626.3.gbk

Remove commas located within quoted fields in a CSV file and create a tab-delimited file

perl -nle  'my @new  = (); push( @new, $+ ) while $_ =~ m{"([^\"\\]*(?:\\.[^\"\\]*)*)",? | ([^,]+),? | ,}gx; push( @new, undef ) if substr( $text, -1, 1 ) eq '\'','\''; for(@new){s/,/ /g} print join "\t", @new' input.csv > output.tab

Remove lines that match a pattern

In this example, lines from input.txt are written to output.txt unless they start with some_text:

perl -n -e 'print unless m/^some_text/' input.txt > output.txt

Replace ^M

perl -p -i -e 's/\r\n$/\n/g' file.txt

Replace commas with tabs

perl -p -e 's/,/\t/g;' input.csv > output.tab

Replace tabs with commas and remove quotes

perl -p -e 's/\t/,/g;' -e 's/"//g;' input.tab > output.csv

Search and replace text on each line

perl -p -e 's/Red Angus/Angus/g' sequenced_samples.csv

Note that multiple substitutions can be performed in succession, e.g.:

echo " test pattern" | perl -pe 's/^\s+//g;' -pe 's/ /,/g;'

The above command produces the following:

test,pattern

Sort sections in a Markdown file based on headings

perl -0777 -ne '(undef,@paragraphs) = split /^#(?=[^#])/m; print map {"#$_"} sort { "\U$a" cmp "\U$b" } @paragraphs;' input.md

Split a Markdown file into separate files based on a heading

Given this input:

# Answer
some answer

# Answer
some more
text

# Answer
the
final
answer

The command below creates three files called output-1.md, output-2.md, and output-3.md containing the text from the first, second, and third # Answer sections, respectively.

For example, output-1.md contains:

# Answer
some answer
perl -ne 'BEGIN {$section_name=shift; $output_file_prefix=shift; undef $/;} $section_count = 1; $file = $ARGV; while (m/(\Q$section_name\E.*?)((?=\Q$section_name\E)|$)/sg) {open(w, ">", "$output_file_prefix-$section_count.md"); print w "$1"; $section_count++; close(w)}' "# Answer" "output" input.md

Python

Create a Python virtual environment

python3 -m venv myenv
source myenv/bin/activate
# install packages, e.g.
pip install beautifulsoup4

Once the virtual environment is activated, the packages installed will only be available within that environment. To exit the virtual environment use deactivate. To activate the environment again use source myenv/bin/activate in the directory where the environment was created.

R

Add columns from one tibble to another

library(purrr)
library(tibble)

# vcf and genotypes are tibbles
# add columns from genotypes to vcf
for (column in names(genotypes)) {
  vcf %>%
    add_column(!!(column) := genotypes[[column]]) ->
    vcf
}

Add comment lines to output

library(dplyr)

# vcf is a tibble
# add comment character to start of first column name
vcf <- rename(vcf, `#CHROM` = CHROM)

# write out comment line and then column names
writeLines(c("##fileformat=VCFv4.2", paste(names(vcf), collapse = "\t")), con = "genotypes.vcf")
write.table(vcf, file = "genotypes.vcf", row.names = FALSE, col.names = FALSE, quote = FALSE, sep = "\t", append=TRUE)

Change values in a column based on values in another column

library(tidyverse)

tb <- tribble(
  ~chr, ~pos, ~sample1, ~sample2, ~A,   ~B,
  #----|-----|---------|---------|-----|-----
  "1",  2,    "AA",     "AB",     "REF","ALT",
  "1",  12,   "BB",     "AA",     "ALT","REF",
  "1",  12,   ".",      "AA",     "ALT","REF",
)

# get names of sample columns
names(tb) %>%
  str_subset(pattern = "^sample") ->
  columns_to_decode

# convert genotypes to values from A and B columns
tb %>%
  mutate_at(
    vars(one_of(columns_to_decode)),
    list(~case_when(
      . == "AA" & A == "REF" ~ "0/0",
      . == "AA" & A == "ALT" ~ "1/1",
      . == "BB" & B == "REF" ~ "0/0",
      . == "BB" & B == "ALT" ~ "1/1",
      . == "AB" ~ "0/1",
      TRUE ~ './.'))) ->
  tb_converted

print(tb_converted)

## A tibble: 3 x 6
#  chr     pos sample1 sample2 A     B
#  <chr> <dbl> <chr>   <chr>   <chr> <chr>
#1 1         2 0/0     0/1     REF   ALT
#2 1        12 0/0     1/1     ALT   REF
#3 1        12 ./.     1/1     ALT   REF

A different approach, using nested ifelse():

library(tidyverse)

tb <- tribble(
  ~chr, ~pos, ~sample1, ~sample2, ~A,   ~B,
  #----|-----|---------|---------|-----|-----
  "1",  2,    "AA",     "AB",     "REF","ALT",
  "1",  12,   "BB",     "AA",     "ALT","REF",
  "1",  12,   ".",      "AA",     "ALT","REF",
)

# get names of sample columns
names(tb) %>%
  str_subset(pattern = "^sample") ->
  columns_to_decode

# function to convert genotypes to values from A and B columns
convert_genotypes <- function (df, col) {
  df[[col]] <-
    ifelse((df[[col]] == "AA") & (df[["A"]] == "REF"), "0/0",
           ifelse((df[[col]] == "AA") & (df[["A"]] == "ALT"), "1/1",
                  ifelse((df[[col]] == "BB") & (df[["B"]] == "REF"), "0/0",
                         ifelse((df[[col]] == "BB") & (df[["B"]] == "ALT"), "1/1",
                                ifelse(df[[col]] == "AB", "0/1", "./.")))))
  return(df)
}

for (sample in columns_to_decode) {
  tb <- convert_genotypes(tb, sample)
}

print(tb)

## A tibble: 3 x 6
#  chr     pos sample1 sample2 A     B
#  <chr> <dbl> <chr>   <chr>   <chr> <chr>
#1 1         2 0/0     0/1     REF   ALT
#2 1        12 0/0     1/1     ALT   REF
#3 1        12 ./.     1/1     ALT   REF

Yet another approach, by passing column names to a function that uses mutate() and case_when():

library(tidyverse)

tb <- tribble(
  ~chr, ~pos, ~sample1_1, ~sample1_2, ~FORWARD_A, ~FORWARD_B,
  #----|-----|-----------|-----------|-----------|-----------
  "1",  2,    "G",        "G",        "G",        "T",
  "1",  12,   "A",        "A",        "C",        "A",
  "1",  12,   ".",        "G",        "T",        "G",
)

# get names of sample columns
names(tb) %>%
  str_subset(pattern = "^sample") ->
  columns_to_decode

# function to convert genotypes to values from A and B columns
convert <- function(df, col, format) {

  A <- paste(format, "A", sep = "_")
  B <- paste(format, "B", sep = "_")

  object <- df %>%
    mutate(
      !!col := case_when(
        eval(parse(text = col)) == eval(parse(text = A)) ~ "A",
        eval(parse(text = col)) == eval(parse(text = B)) ~ "B",
        TRUE ~ "."
      )
    )
  return(object)
}

for (sample in columns_to_decode) {
  tb <- convert(tb, sample, "FORWARD")
}

print(tb)

## A tibble: 3 x 6
# chr     pos sample1_1 sample1_2 FORWARD_A FORWARD_B
# <chr> <dbl> <chr>     <chr>     <chr>     <chr>
#1 1         2 A         A         G         T
#2 1        12 B         B         C         A
#3 1        12 .         B         T         G

Cluster gene lists based on overlap and identify shared genes

In this example a heatmap is used to visualize gene presence and absence for all gene lists in the gene_lists directory. In this directory each list is given as a separate .txt file, with a single header row and one gene name or ID per row, for example:

Gene name or identifier
ENSG00000264954.2
ENSG00000224383.8
CCDS54157.1.1

The following uses the purrr and RVenn packages:

library(purrr)
library(RVenn)

setwd('/path/to/gene_lists')
filenames <- list.files(pattern = "*.txt", full.names = FALSE)

# create list of character vectors, each named after the source filename
# assumes each file has single header line (skip = 1)
gl <- sapply(filenames, scan, character(), sep="\n", skip = 1, USE.NAMES = TRUE)

# remove underscores from vector names
names(gl) <- gsub(x = names(gl), pattern = "_", replacement = " ")

# remove file extension from vector names
names(gl) <- gsub(x = names(gl), pattern = "\\..+?$", replacement = "")

venn = Venn(gl)
setmap(venn, element_fontsize = 4, set_fontsize = 4)

The resulting heatmap displays genes and gene lists as rows and columns, respectively. The columns and rows are arranged so that genes and gene lists with similar presence / absence patterns are grouped together.

Combine multiple input files

In the following example the rows from multiple files are combined. Additional columns are used to track the source of each row. The resulting long data is converted into two different wide formats and written to a single Excel file as separate worksheets.

The input files are structured as follows, with additional columns not shown:

fusion_name, junction_read_count
Wfdc3--AABR07030443.2, 16
Wfdc3--AABR07030443.2, 2
Pdk4--Pdk2, 10
AABR07059159.1--Actr3b, 8

Each file is named after the source sample. For example 180_S1_R1_001.fusion_candidates.preliminary is the data for sample 180_S1_R1_001.

library(tidyverse)
library(janitor)
library(xlsx)

# directory containing the files
input_dir <- "data/input/"
# pattern to use when identifying input files
file_pattern <- "*.preliminary"

# create tibble of input files (full path and file name in separate columns)
input_files <-
  tibble(
    full_path = list.files(input_dir, pattern = file_pattern, full.names = TRUE),
    file_name = list.files(input_dir, pattern = file_pattern, full.names = FALSE)
  )

# function to add source info to each row
read_tsv_and_add_source <- function(file_name, full_path) {
  read_tsv(full_path) %>%
    clean_names %>%
    mutate(file_name = file_name) %>%
    mutate(full_path = full_path) %>%
    # convert '180_S1_R1_001.fusion_candidates.preliminary' to '180_S1_R1_001'
    mutate(sample = str_split(file_name, ".fusion", simplify = TRUE)[[1]])
}

# read all files into a single tibble
input_files %>%
  rowwise() %>%
  do(., read_tsv_and_add_source(.$file_name, .$full_path)) ->
  combined_data_with_source

# group data by fusion_name and sample and for each group calculate the sum of
# junction_read_count
combined_data_with_source %>%
  group_by(fusion_name, sample) %>%
  summarise(fusion_count = sum(junction_read_count), .groups = NULL) ->
  counts_per_fusion

# filter by fusion_name, keeping rows where fusion_name consists of two MT
# genes, for example Mt-co1--Mt-nd2
counts_per_fusion %>%
  filter(str_detect(fusion_name, "^Mt-")) %>%
  filter(str_detect(fusion_name, "--Mt-")) ->
  counts_per_MT_fusion

# convert the data from long to wide, with values of sample becoming columns
counts_per_MT_fusion %>%
  spread(sample, fusion_count) %>%
  replace(is.na(.), 0) ->
  samples_as_columns

# convert the data from long to wide, with values of fusion_name becoming
# columns
counts_per_MT_fusion %>%
  spread(fusion_name, fusion_count) %>%
  replace(is.na(.), 0) ->
  fusions_as_columns

# write the data to an Excel file
write.xlsx(
  as.data.frame(samples_as_columns),
  "output.xlsx",
  sheetName = "Samples as columns",
  col.names = TRUE,
  row.names = FALSE,
  append = TRUE
)

write.xlsx(
  as.data.frame(fusions_as_columns),
  "output.xlsx",
  sheetName = "Fusions as columns",
  col.names = TRUE,
  row.names = FALSE,
  append = TRUE
)

Compare two data sets to find differences

In this example SNP location information assigned by two different algorithms is compared using the compareDF package.

The two data sets (position information) generated by the differing algorithms are read from files. SNP name is used to match rows across the data sets, and then the 'chromosome' and 'position' are compared.

SNP records for which 'chromosome' or 'position' differ between the data sets are written to an Excel file.

library(compareDF)

algorithm1_results <- read.csv2("algorithm1_results.csv", comment.char = "#", sep = ",", header = TRUE)
algorithm1_results_snp_positions <- data.frame(algorithm1_results$marker_name, algorithm1_results$chromosome, algorithm1_results$position)
colnames(algorithm1_results_snp_positions) <- c('SNP_name', 'chromosome', 'position')

algorithm2_results <- read.csv2("algorithm2_results.csv", comment.char = "#", sep = ",", header = TRUE)
algorithm2_results_snp_positions <- data.frame(algorithm2_results$SNP_name, algorithm2_results$chromosome, algorithm2_results$position)
colnames(algorithm2_results_snp_positions) <- c('SNP_name', 'chromosome', 'position')

#compare positions between data sets, matching based on SNP_name
ctable = compare_df(algorithm1_results_snp_positions, algorithm2_results_snp_positions, c('SNP_name'))
output_file <- paste("positions", "algorithm1_results", "vs", paste("algorithm2_results", ".xlsx", sep=""), sep="_")
create_output_table(ctable, output_type="xlsx", file_name=output_file, limit=1000000)

Filter and sort rows

library(tidyverse)

# vcf is tibble
# remove rows where POS is NA
vcf %>% drop_na(POS) ->
  vcf

# keep rows with single base in REF and ALT
vcf %>%
  filter(str_detect(REF, "^[GATCN]$")) %>%
  filter(str_detect(ALT, "^[GATCN]$")) ->
  vcf

# sort by chromosome then position
vcf %>%
  arrange(CHROM, POS) ->
  vcf

Split multi-locus genotype strings into multiple columns and decode genotypes

To convert this:

sample          alleles
HOCANF12689774  1000112112
HOCANF12689787  2011112012
HOCANF12689790  1011002122

To this:

sample          Hapmap43437-BTA-101873  ARS-BFGL-NGS-16466  Hapmap34944-BES1_Contig627_1906  ARS-BFGL-NGS-98142  Hapmap53946-rs29015852  ARS-BFGL-NGS-114208  ARS-BFGL-NGS-66449  ARS-BFGL-BAC-32770  ARS-BFGL-NGS-65067  ARS-BFGL-BAC-32722
HOCANF12689774  AB                      BB                  BB                               BB                  AB                      AB                   AA                  AB                  AB                  AA
HOCANF12689787  AA                      BB                  AB                               AB                  AB                      AB                   AA                  BB                  AB                  AA
HOCANF12689790  AB                      BB                  AB                               AB                  BB                      BB                   AA                  AB                  AA                  AA

Use this:

library(dplyr)
library(tidyr)

# prepare sample data frame
sample <- c('HOCANF12689774', 'HOCANF12689787', 'HOCANF12689790')
alleles <- c('1000112112', '2011112012', '1011002122')
genotypes <- data.frame(sample, alleles)

# vector of snp names
snps <- c('Hapmap43437-BTA-101873', 'ARS-BFGL-NGS-16466', 'Hapmap34944-BES1_Contig627_1906', 'ARS-BFGL-NGS-98142', 'Hapmap53946-rs29015852', 'ARS-BFGL-NGS-114208', 'ARS-BFGL-NGS-66449', 'ARS-BFGL-BAC-32770', 'ARS-BFGL-NGS-65067', 'ARS-BFGL-BAC-32722')

# create a new column for each digit in alleles
genotypes_one_column_per_snp <- separate(genotypes, col = alleles, sep = "(?<=\\d)", into = snps)

# convert each digit to textual representation
genotypes_one_column_per_snp_decoded = reshape2::dcast(
  dplyr::mutate(
    reshape2::melt(genotypes_one_column_per_snp, id.var = "sample"),
    value=plyr::mapvalues(
      value, c("0", "1", "2"), c("BB", "AB", "AA"))
  ),sample~variable)

write.table(genotypes_one_column_per_snp_decoded, file = "genotypes_one_column_per_snp_decoded.txt", row.names = FALSE, col.names = TRUE, quote = FALSE, sep = " ")

Split two-allele genotypes into two columns

To convert this:

sample   ABCA12  APAF1  ARS-BFGL-BAC-10172  ARS-BFGL-BAC-1020
sample1  AA      CC     GG                  AA
sample2  AA      CC     AG                  GG

To this:

sample   ABCA12_1  ABCA12_2  APAF1_1  APAF1_2  ARS-BFGL-BAC-10172_1  ARS-BFGL-BAC-10172_2  ARS-BFGL-BAC-1020_1  ARS-BFGL-BAC-1020_2
sample1  A         A         C        C        G                     G                     A                    A
sample2  A         A         C        C        A                     G                     G                    G

Use this:

library(dplyr)
library(tidyr)

# prepare sample data frame
sample <- c('sample1', 'sample2')
ABCA12 <- c('AA', 'AA')
APAF1 <- c('CC', 'CC')
`ARS-BFGL-BAC-10172` <- c('GG', 'AG')
`ARS-BFGL-BAC-1020` <- c('AA', 'GG')
genotypes <- tibble(sample, ABCA12, APAF1, `ARS-BFGL-BAC-10172`, `ARS-BFGL-BAC-1020`)

# [-1] prevents first column from being split
for(column_name in names(genotypes)[-1]){
  genotypes %>%
    separate(column_name, c(paste(column_name, "1", sep = "_"), paste(column_name, "2", sep = "_")), sep = 1) ->
    genotypes
}

write.table(genotypes, file = "genotypes_split.txt", row.names = FALSE, col.names = TRUE, quote = FALSE, sep = " ")

Transpose a data frame

To convert this:

snp                 sample1  sample2
ABCA12              AA       AA
APAF1               CC       CC
ARS-BFGL-BAC-10172  GG       AG
ARS-BFGL-BAC-1020   AA       GG

To this:

snp      ABCA12  APAF1  ARS-BFGL-BAC-10172  ARS-BFGL-BAC-1020
sample1  AA      CC     GG                  AA
sample2  AA      CC     AG                  GG

Use this:

library(dplyr)
library(tidyr)
library(janitor)

# prepare sample data frame
snp <- c('ABCA12', 'APAF1', 'ARS-BFGL-BAC-10172', 'ARS-BFGL-BAC-1020')
sample1 <- c('AA', 'CC', 'GG', 'AA')
sample2 <- c('AA', 'CC', 'AG', 'GG')
genotypes <- data.frame(snp, sample1, sample2)

genotypes %>%
  tibble::rownames_to_column() %>%
  pivot_longer(-rowname) %>%
  pivot_wider(names_from=rowname, values_from=value) ->
  genotypes_transposed

genotypes_transposed %>%
  row_to_names(row_number = 1) ->
  genotypes_transposed_with_column_names

write.table(genotypes_transposed_with_column_names, file = "genotypes_transposed_with_column_names.txt", row.names = FALSE, col.names = TRUE, quote = FALSE, sep = " ")

Or use this:

snp <- c('ABCA12', 'APAF1', 'ARS-BFGL-BAC-10172', 'ARS-BFGL-BAC-1020')
sample1 <- c('AA', 'CC', 'GG', 'AA')
sample2 <- c('AA', 'CC', 'AG', 'GG')
genotypes <- data.frame(snp, sample1, sample2)

genotypes_transposed <- data.frame(t(genotypes[-1]))
colnames(genotypes_transposed) <- genotypes[, 1]

write.table(genotypes_transposed, file = "genotypes_transposed_with_column_names.txt", row.names = FALSE, col.names = TRUE, quote = FALSE, sep = " ")

Or use datamash.

Understand an object

When working with R, especially in exploratory data analysis or when inheriting someone else's code, you might encounter objects of unknown type or structure. Below are some functions to help you inspect and understand such objects:

# Assume 'object' is the unknown object you're trying to inspect

# Check the class of the object
class(object)
#> "data.frame", "numeric", "factor", etc.

# Check the underlying type or storage mode
typeof(object)
#> "double", "integer", "list", "character", etc.

# Get the dimensions (if applicable, e.g., for matrices and data frames)
dim(object)
#> e.g., c(100, 5) for a data frame with 100 rows and 5 columns

# Check the length (number of elements or components)
length(object)
#> e.g., 100 for a vector of length 100

# View a compact structure of the object
str(object)
#> Outputs structure directly to the console

# Inspect all attributes of the object
attributes(object)
#> e.g., $names, $class, $row.names, etc.

# Get a statistical summary (if applicable)
summary(object)
#> Summary statistics for each column of a data frame, for example

# Preview the first few elements or rows of the object
head(object)
#> The first 6 elements for vectors or the first 6 rows for data frames

# Check if the object is of certain types
is.vector(object)
is.list(object)
is.matrix(object)
#> Returns TRUE or FALSE

Use an R virtual environment

To create an R virtual environment using renv:

  1. Launch R in the terminal, in your project root directory:

    bash r

  2. Install the renv package and initialize the project:

    r install.packages("renv") renv::init()

  3. Install any required packages:

    r required_packages <- c( "data.table", "ggfortify", "ggplot2", "janitor", "openxlsx", "tidyverse", "writexl" ) install.packages(required_packages) renv::snapshot()

To export an R virtual environment, run the following within an R notebook to create an renv.lock lock file:

if (requireNamespace("renv", quietly = TRUE) && renv::status()$active) {
  renv::snapshot()
  message("renv snapshot taken to save the current state of the project library.")
} else {
  message("renv is not active. No snapshot taken.")
}

Or, in the terminal in the project root:

r -e 'if (requireNamespace("renv", quietly = TRUE) && renv::status()$active) renv::snapshot()'

To create renv from the lock file:

  1. Launch R in the terminal, in the project root directory:

    bash r

  2. Install the renv package and restore the project:

    r install.packages("renv") renv::restore()

Visualize the degree of overlap among gene sets

In this example, an UpSet plot is used to visualize the overlap among all combinations of gene lists in the gene_lists directory. In this directory each list is given as a separate .txt file, with a single header row and one gene name or ID per row, for example:

Gene name or identifier
ENSG00000264954.2
ENSG00000224383.8
CCDS54157.1.1

The UpSet plot is generated using the UpSetR package:

library(UpSetR)

setwd('/path/to/gene_lists')
filenames <- list.files(pattern = "*.txt", full.names = FALSE)

# create list of character vectors, each named after the source filename
# assumes each file has single header line (skip = 1)
gl <- sapply(filenames, scan, character(), sep="\n", skip = 1, USE.NAMES = TRUE)

# remove underscores from vector names
names(gl) <- gsub(x = names(gl), pattern = "_", replacement = " ")

# remove file extension from vector names
names(gl) <- gsub(x = names(gl), pattern = "\\..+?$", replacement = "")

upset(fromList(gl), nsets = length(gl), order.by = "freq")

The resulting plot displays the number of items shared among all possible combinations of overlapping sets in an easy-to-interpret and parse manner (unlike a traditional Venn diagram).

rsync

Sync a directory from a remote system

rsync -avzh user@192.168.0.101:~/source_directory destination

Sync a directory on local system

rsync -avzh source_directory destination_directory

To sync only the contents of source_directory and not the directory itself use:

rsync -avzh source_directory/ destination_directory

Sync a directory to a remote system

rsync -avzh source_directory user@192.168.0.101:~/destination

sed

Add a header line to a file with sed

sed $'1s/^/my header text\\\n&/' input

Change filenames using a regular expression

In this example chr30 is replaced with chrX:

for f in *.fasta; do new=`echo $f | sed 's/chr30/chrX/'`; mv $f $new; done

Delete lines

The following deletes the first line:

sed '1d' sequenced_samples.csv

The following deletes from line 500 to the end of the file (represented by $):

sed '500,$d' sequenced_samples.csv

Edit the header line with sed

In this example pos,reads_pp is changed to pos,reads in the first line of the file. The -i is used to edit the file in place:

sed -i '' -e "1,1s/pos,reads_pp/pos,reads/" input.csv

In this example line 26404 is printed:

sed -n "26404p" input.txt

Search and replace on lines

The sed command can be used to find and replace text and supports its own regular expression syntax.

The following replaces all occurrences of Red Angus with Angus:

sed 's/Red Angus/Angus/g' sequenced_samples.csv

In the above the g indicates that all matches on a line should be replaced.

The following restricts the processing to lines 302 to 305:

sed '302,305 s/Red Angus/Angus/g' sequenced_samples.csv

The following replaces the first occurrence of LIM on each line with ---:

sed 's/LIM/---/1' sequenced_samples.csv

The following adds underscores around the first three characters of each line:

sed 's/^\([a-zA-Z0-9]\{3\}\)/_\1_/g' sequenced_samples.csv

The above uses \( and \) to "remember" matching characters and then uses \1 to use the stored matching text in the replacement portion. Thus the replacement text becomes _ followed by the actual matched text, followed by _.

The different parts of the search part of the command have the following meanings:

  • ^ match the start of a line
  • [a-zA-Z0-9]\{3\} match three letters or numbers

Share data with project group members

cd projects/some_project
chmod g+x my_dir
cd my_dir
mkdir shared_dir
chmod g+x shared_dir
chmod +t shared_dir

Singularity

Create an image from a container stored in Docker Hub

In this example a container that can be downloaded from Docker Hub using docker pull pstothard/cgview is used to generate a Singularity container:

singularity build cgview.sif docker://pstothard/cgview

To run a command in this container, use something like the following:

singularity exec -B /scratch cgview.sif java -jar /usr/bin/cgview.jar --help

The -B is used to provide the container with access to directories.

Slurm

Cancel a job

scancel <jobid>

Cancel all jobs

scancel -u <username>

Run a Snakemake workflow

The module load command can be included within the shell sections of a Snakemake workflow, to load the software needed for the commands that follow.

Sometimes different modules have conflicting software environments, so they are usually loaded only in the shell sections where they are required, e.g.:

shell:
    """
    module load emboss
    # commands here that use emboss
    """

If there is a module that needs to be loaded for every rule, the shell.prefix() command can be added to the top of the Snakefile. Note the semicolon and space before the final double quote in the value passed to shell.prefix():

shell.prefix("module load python/3.8; ")

Resource requests are specified for each rule where the jobs are submitted to the cluster, using the resources parameter. In the following example, the cores value specifies the number of cores for a multi-threaded application, mem_mb is the amount of memory requested in megabytes, and runtime is the walltime requested, in minutes:

resources:
    cores = 1,
    mem_mb = 100,
    runtime = 30

Rules that run commands that require few resources to run (e.g. downloading a small file) can be marked as localrules, which causes Snakemake to run them directly on the login instead of submitting them to the job queue for execution on a compute node:

localrules: gc_content, some_other_rule

Here is a simple Snakemake workflow (saved in a file called Snakefile) for calculating the GC content of sequences:

accessions, = glob_wildcards("fasta_files/{accession}.fa")

rule final:
    input:
        "result/gc_table.txt"

rule gc_content:
    input:
        "fasta_files/{accession}.fa"
    output:
        "gc/{accession}_gc.txt"
    params:
        "{accession}"
    resources:
        cores = 1,
        mem_mb = 100,
        runtime = 30
    shell:
        """
        module load emboss
        GC=$(infoseq -noheading -auto -only -pgc {input})
        echo "{params}: $GC" > {output}
        """

rule collect_gc:
    input:
        expand("gc/{accession}_gc.txt", accession=accessions)
    resources:
        cores = 1,
        mem_mb = 100,
        runtime = 30
    output:
        "result/gc_table.txt"
    shell:
        "cat {input} > {output}"

Install Snakemake using pip:

module load python
pip install snakemake --user

Once installed, the snakemake command can be used to run the workflow. You don't need to reinstall Snakemake each time you want to run a workflow. The --user option used above installs Snakemake in your home directory.

To run the workflow, use the snakemake command with the --cluster parameter:

sbc="sbatch -N 1 -c {resources.cores}\
 --mem={resources.mem_mb}\
 --time={resources.runtime}\
 --account=def-someuser"
snakemake --cluster "$sbc" --printshellcmds -j 10

When the above command is run, Snakemake will display progress to the screen as it submits jobs. Typically you would use tmux or screen to run Snakemake in a terminal session that you can disconnect from and reconnect to later, however this workflow is simple enough that it should complete in a few minutes.

Note that a --dry-run option can be added to a snakemake command to see what jobs will be run but without actually executing them.

The --printshellcmds option used above is useful for troubleshooting as it prints to the screen exactly what is submitted by the shell section of a rule. Here is an example of the rule gc_content shell commands printed to the screen:

module load emboss
GC=$(infoseq -noheading -only -pgc fasta_files/NC_005831.2.fa)
echo "NC_005831.2: $GC" > gc/NC_005831.2_gc.txt

Using the -j flag to limit the number of currently submitted or running jobs can help prevent reductions in your account's priority on the cluster. This option is especially important when running a workflow that has the potential of submitted hundreds of jobs simultaneously.

Once the jobs are submitted their status can be checked:

squeue -u $USER

Once the workflow has completed, the results can be viewed:

more result/gc_table.txt

Run an nf-core Nextflow workflow

The nf-core project provides a collection of Nextflow workflows for bioinformatics.

In the following example the nf-core/sarek workflow for detecting germline or somatic variants is used to process a test data set.

See the DRAC Nextflow documentation for more information on running Nextflow workflows on Alliance clusters.

First, load some modules and install nf-core tools using a Python virtual environment and pip (this step is slow but only needs to be done once). The nf-core tools package can be used to download nf-core pipelines and dependencies:

module purge && module load python/3.8 && module load postgresql/15.3
python -m venv $HOME/nf-core-env # create a virtual environment
source $HOME/nf-core-env/bin/activate # activate the environment
python -m pip install nf_core==2.6 # install nf-core tools in the environment

In the future you can activate the environment using:

source $HOME/nf-core-env/bin/activate

To deactivate the environment use:

deactivate

To view a list of available nf-core pipelines use the following:

source $HOME/nf-core-env/bin/activate
nf-core list

Set environment variables to store the name of the pipeline we are going to run and its version:

export NFCORE_PL=sarek; export PL_VERSION=3.2.0

sarek is the name of the pipeline, and 3.2.0 is the version. The export command allows you to set environment variables that will be available to any commands you run in the current shell session, including jobs submitted to the cluster.

If you log out of the cluster you will need to set these variables again for some of the commands below to work.

Create a folder to hold Apptainer/Singularity containers. Apptainer/Singularity is a containerization platform like Docker. These containers will provide the programs that the pipeline will execute as it runs (e.g. bwa and samtools):

mkdir -p ~/scratch/singularity

Set an environment variable to tell nf-core tools and Nextflow where we want the containers stored (both programs use the $NXF_SINGULARITY_CACHEDIR environment variable for this purpose):

export NXF_SINGULARITY_CACHEDIR=~/scratch/singularity

Download the pipeline and the containers it uses:

cd ~/scratch
module load nextflow/22.10.6
module load apptainer/1.1.6
nf-core download --singularity-cache-only --container singularity \
--compress none -r ${PL_VERSION} -p 6 ${NFCORE_PL}

The pipeline code is downloaded to the working directory whereas the containers are downloaded to the folder specified by the NXF_SINGULARITY_CACHEDIR environment variable.

With the pipeline and containers downloaded, we can now run the pipeline using a test data set provided by the pipeline developers.

Create a Nextflow configuration file called nextflow.config containing the following:

singularity{
  autoMounts = true
}

process {
  executor = 'slurm' 
  pollInterval = '60 sec'
  submitRateLimit = '60/1min'
  queueSize = 100 
  errorStrategy = 'retry'
  maxRetries = 1
  errorStrategy = { task.exitStatus in [125,139] ? 'retry' : 'finish' }
  memory = { check_max( 4.GB * task.attempt, 'memory' ) }
  cpu = 1  
  time = '3h' 
}

profiles {
  beluga{
    max_memory='186G'
    max_cpu=40
    max_time='168h'
  }
  narval{
    max_memory='249G'
    max_cpu=64
    max_time='168h'
  }
  cedar{
    max_memory='124G'
    max_cpu=32
    max_time='168h'
  }
}

To create this file using vim enter vim nextflow.config and then in vim use :set paste to enter paste mode. Next, right-click to paste the above, then enter :set nopaste to exit paste mode, and enter :wq to save and exit.

Nextflow itself uses too many resources to be run on the login node, so we will run it as a job. Create a batch script called sarek.sbatch with the following contents:

#!/bin/bash
#SBATCH --job-name=sarek
#SBATCH --output=sarek_%j.out
#SBATCH --error=sarek_%j.err
#SBATCH --ntasks=1
#SBATCH --cpus-per-task=4
#SBATCH --mem=16000M
#SBATCH --time=3:00:00

module load nextflow/22.10.6
module load apptainer/1.1.6

nextflow run nf-core-${NFCORE_PL}-${PL_VERSION}/workflow/ \
--clusterOptions "--account=def-${USER}" \
-c nextflow.config \
-ansi-log false -resume \
-profile test,singularity,cedar --outdir sarek_output

To create in vim enter vim sarek.sbatch and then in vim use :set paste to enter paste mode. Right-click to paste the above, enter :set nopaste to exit paste mode, and enter :wq to save and exit.

The script loads two modules that are needed to run Nextflow and the Apptainer/Singularity containers.

The nextflow run command is used to run the workflow we downloaded earlier.

The --clusterOptions option is used to pass options to the Slurm job scheduler. In this case we are requesting that the job be run using our default allocation.

A nextflow.conf file provides information to help Nextflow run jobs on the cluster. This configuration file is passed to Nextflow using the -c option and can be reused for other Nextflow workflows.

The -ansi-log false option is used to disable the use of ANSI escape codes in the log file. This is useful when viewing the log file in a text editor.

The -resume option is used to tell Nextflow to resume a previous run if it was interrupted. This option is useful when running a workflow that takes a long time to complete, since any intermediate results that were generated will be used instead of being regenerated.

The --profile option is used to specify that test data will be used, that Apptainer/Singularity containers will be used, and that the pipeline will be run using information provided in the cedar section of the nextflow.config file.

The --outdir option specifies the folder where the pipeline results will be written.

Submit the batch job:

sbatch --account=def-${USER} sarek.sbatch

To view the status of the job:

squeue --format="%i %u %j %t" -u $USER | column -t

Once this job is running, Nextflow will start submitting its own jobs, for the various steps of the pipeline. These jobs will be included in the output of the squeue command. You can log out of the cluster and the pipeline will continue to run.

Once all the jobs are complete, examine the .out and .err files as well as the files in the sarek_output folder.

The .out file will contain progress and error messages and will indicate whether the pipeline completed successfully. The .err file may contain error messages depending on the types of errors encountered.

The work folder that is created by Nextflow contains the output of each step of the pipeline. The contents of this folder can be used to resume a pipeline run if it is interrupted.

If the pipeline doesn't complete within the requested time (3 hours) you can re-run it using the same command as before, and it will continue from where it left off. You can also double the time requested by adding --time=6:00:00 to the sbatch command.

Note that if you log out of the cluster you will need to set the environment variables again before re-running the pipeline:

cd ~/scratch
source $HOME/nf-core-env/bin/activate
export NXF_SINGULARITY_CACHEDIR=~/scratch/singularity; \
export NFCORE_PL=sarek; export PL_VERSION=3.2.0

Running an nf-core pipeline on a full data set requires preparing the necessary input files and providing more information to the pipeline using command-line parameters. See the nf-core/sarek documentation for more information on how to do this with the sarek pipeline. You will also want to increase the time requested in the sarek.sbatch file.

It isn't unusual for some jobs to fail when running a pipeline on a full data set. These failures can be due to a variety of reasons, including insufficient resources requested, or a problem with the input data.

The error messages in the .out file serve as a starting point when trying to overcome failed runs. The -resume option helps to minimize the impact of these failures by allowing the pipeline to resume from the point of failure.

Note that the scratch folder is regularly cleaned out by administrators. If you want to keep the pipeline results, move them to your project or home folder, or download them to your local computer.

Start an interactive session

salloc --time=2:0:0 --ntasks=2 --account=def-someuser --mem-per-cpu=8000M --mail-type=ALL --mail-user=your.email@example.com

View accounting information for completed jobs

sacct -s CD --format=JobID,JobName,MaxRSS,ReqMem,Elapsed,End,State,NodeList

View detailed information for a specific job

scontrol show job -dd <jobid>

View jobs

squeue -u <username>

View pending jobs

squeue -u <username> -t PENDING

View running jobs

squeue -u <username> -t RUNNING
seff <jobid>

sort

Alphabetical sort

sort -t, input.csv

Sort a file with a header row

In the following examples a file with a single header line is sorted:

(head -n 1 sequenced_samples.csv && sort -t, <(tail -n +2 sequenced_samples.csv))
(head -n 1 sequenced_samples.csv && tail -n +2 sequenced_samples.csv | sort -t,)
cat sequenced_samples.csv | awk 'NR<2{print $0; next}{print $0| "sort -t','"}'

The above command can be modified to sort by the second column, numerically from smallest to largest:

cat sequenced_samples.csv | awk 'NR<2{print $0; next}{print $0| "sort -t',' -k2,2n"}'

Sort by chromosome

This example uses the following input from the text file input.txt:

chrX Other
chrY Information
MT !
chr1 Some
chr2 Data
chr3 Or
chr3 Annotation
chr10 Or
chr21 Any

To sort by chromosome use the following:

sort -k1,1 -V -f -s input.txt

The above generates the following output:

chr1 Some
chr2 Data
chr3 Or
chr3 Annotation
chr10 Or
chr21 Any
chrX Other
chrY Information
MT !

Specify the sort field

The -k option of sort is used to indicate that certain fields are to be used for sorting (the sorting is still applied to the entire line).

The following sorts only using column 5 (5,5 means "starting at column 5 and ending at column 5"), numerically, from smallest to largest:

(head -n 1 sequenced_samples.csv && \
tail -n +2 sequenced_samples.csv | sort -t, -k5,5n)

The following sorts using column 2 to the end of line, alphabetically:

(head -n 1 sequenced_samples.csv && sort -t, -k2 \
<(tail -n +2 sequenced_samples.csv))

Use multiple sort fields

The command below sorts using column 2, breaking ties using the value in column 5 (sorting numerically from largest to smallest). The input file has a single header row, which is excluded from the sort.

cat sequenced_samples.csv | awk \
'NR<2{print $0; next}{print $0| "sort -t, -k2,2 -k5,5nr"}'

tmux

Create a multi-pane tmux session

The following creates three panes: one large one at the top and two smaller ones at the bottom:

tmux new-session -s multiple \; \
split-window -v -p 25 \; \
split-window -h -p 50 \; \
select-pane -t 0 \;

The following also creates a three-pane tmux session, and launches vim in the largest pane:

tmux new-session -s multiple \; \
send-keys 'vim' C-m \; \
split-window -v -p 25 \; \
split-window -h -p 50 \; \
select-pane -t 0 \;

The following creates six equally sized panes:

tmux new-session -s multiple \; \
split-window -h \; \
split-window -v -p 66 \; \
split-window -v \; \
select-pane -t 0 \; \
split-window -v -p 66 \; \
split-window -v \;

Detach a tmux session

Ctrl-b then d.

Join a tmux session

tmux attach -t session_name

Kill a tmux session

tmux kill-session -t session_name

List tmux sessions

tmux ls

Ctrl-b then an arrow key.

The following commands work with my configuration:

Ctrl-j moves up. Ctrl-k moves down. Ctrl-h moves left. Ctrl-l moves right.

Scroll in tmux

Ctrl-b then PgUp. Press q to return to normal mode.

Alternatively you can use Ctrl-b then [ and then navigation keys like Up Arrow or PgDn. Press q to return to normal mode.

Start a tmux session

tmux new -s session_name

tr

Delete characters

Use the -d option with tr to delete characters.

The following tr command deletes all digits:

cat sequenced_samples.csv | tr -d "[:digit:]"

To delete everything except for digits using the following tr command:

cat sequenced_samples.csv | tr -c -d "[:digit:]"

Squeeze characters

"Squeezing" is used here to mean "removing repeated instances". Typically this would be used to remove duplicated spaces or punctuation.

The following illustrates the removal extra commas by using tr with the -s option:

echo "a,b,,c,,,d" | tr -s ","

Translate characters

The following changes all S and H characters to s and h, respectively:

cat sequenced_samples.csv | tr "SH" "sh"

The sets of characters provided to tr can be the actual characters (as in the above example) or they can be one of several special characters or character groups (use tr --help to learn more).

For example, the following tr command changes uppercase text to lowercase text:

cat sequenced_samples.csv | tr "[:upper:]" "[:lower:]"

To change all digits to X use tr as in the following example:

cat sequenced_samples.csv | tr "[:digit:]" "X"

The following tr command changes all characters that aren't G, A, T, or C (ignoring case) or whitespace to N:

echo "garsxnT" | tr -c "GATCgatc[:space:]" "N"

The above command uses the complement option (-c) to convert the first set to everything that isn't in the set.

VCF files

Add all INFO tags

To add all tags, e.g. AC_Hom, AC_Het, etc:

bcftools +fill-tags input.vcf -o output.vcf

Add predicted consequences

Use SnpEff to predict variant effects.

List available pre-built databases for annotation:

java -jar snpEff.jar databases

Download a database:

java -jar snpEff.jar snpEff download -v CanFam3.1.99

Annotate a VCF file:

java -jar snpEff.jar -Xmx8g CanFam3.1.99 input.vcf > input.ann.vcf

Alternatively, use Ensembl VEP to predict variant effects. VEP can be used to annotate structural variants.

SPECIES=canis_lupus
ASSEMBLY=CanFam3.1
INPUT=input.vcf
VEP_CACHE=vep
OUTDIR=vep_annotated
WD="$(pwd)"
export PERL5LIB="$PERL5LIB:$WD/$VEP_CACHE"
export DYLD_LIBRARY_PATH="$DYLD_LIBRARY_PATH:$WD/$VEP_CACHE/htslib"

# create cache directory and output directory
mkdir -p $OUTDIR
mkdir -p $VEP_CACHE

# build cache
vep_install -a cfp -s $SPECIES -y $ASSEMBLY \
-c $VEP_CACHE \
-d $VEP_CACHE \
--PLUGINS all --CONVERT

# run vep
SPECIES=canis_lupus_familiaris
vep --cache --format vcf --vcf \
--dir_cache $VEP_CACHE \
--dir_plugins $VEP_CACHE/Plugins \
--input_file $INPUT \
--output_file $OUTDIR/$INPUT \
--species $SPECIES --assembly $ASSEMBLY \
--max_sv_size 1000000000 \
--force_overwrite \
--plugin Blosum62 --plugin Downstream --plugin Phenotypes --plugin TSSDistance --plugin miRNA \
--variant_class --sift b --nearest gene --overlaps --gene_phenotype --regulatory --protein \
--symbol --ccds --uniprot --biotype --domains --check_existing --no_check_alleles --pubmed \
--verbose

Add variant IDs

Use SnpSift annotate to add variant IDs.

In this example the file canis_lupus_familiaris.sorted.vcf has variant IDs to be transferred to input.vcf.

bgzip canis_lupus_familiaris.sorted.vcf
tabix -p vcf canis_lupus_familiaris.sorted.vcf.gz
java -jar SnpSift.jar annotate \
canis_lupus_familiaris.sorted.vcf.gz \
input.vcf > input.rsID.vcf

Assess sex by calculating X-chromosome heterozygosity

# vcftools adds .het extension to output automatically, so output becomes output.vcf.het
vcftools --vcf input.vcf --chr X --het --out output.vcf
# add column to vcftools output reporting percent heterozygous genotypes
awk -F$'\t' 'BEGIN{OFS="\t"}; {if(NR==1){print $0,"Percent HET"} else {print $0, ($4 - $2) / $4 * 100}}' output.vcf.het > output.vcf.percent_het

Use --check-sex in plink.

First convert the VCF file to a plink binary fileset:

species=dog
pseudoX_start=340475
pseudoX_end=6642728
mkdir plink_bed
plink --vcf input.vcf --make-bed --allow-extra-chr \
--$species --split-x $pseudoX_start $pseudoX_end \
--out plink_bed/input

Next edit the .fam file in plink_bed to describe family relationships, sex, and case / control status.

The following is from the plink documentation:

A text file with no header line, and one line per sample with the following six fields:

Family ID ('FID') Within-family ID ('IID'; cannot be '0') Within-family ID of father ('0' if father isn't in dataset) Within-family ID of mother ('0' if mother isn't in dataset) Sex code ('1' = male, '2' = female, '0' = unknown) Phenotype value ('1' = control, '2' = case, '-9'/'0'/non-numeric = missing data if case/control)

Use --check-sex:

mkdir plink_check_sex
plink --bfile plink_bed/input --check-sex --allow-extra-chr \
--$species --out plink_check_sex/input
cat plink_check_sex/input.sexcheck

In the output 1 = male, 2 = female, other = unknown.

Change sample order

First determine current order of samples:

bcftools query -l input.vcf > sample_order.txt

Next edit sample_order.txt to reflect the desired sample order.

For example, change the contents from this:

M-9
M-10
M-15
M-16
M-2

To this:

M-2
M-9
M-10
M-15
M-16

Generate a VCF file with the new sample order:

bgzip input.vcf
tabix -p vcf input.vcf.gz
bcftools view -S sample_order.txt \
input.vcf.gz > input.revised_sample_order.vcf

Check relatedness between samples

Use the KING algorithm, which is implemented in vcftools and is accessed using the --relatedness2:

mkdir relatedness
vcftools --vcf input.vcf --not-chr X --max-missing-count 0 --relatedness2 \
--out relatedness/input.vcf
cat relatedness/input.vcf.relatedness2 | column -t

Combine rows / concatenate files from the same set of samples

Note that when using this approach the source files must have the same sample columns appearing in the same order.

In this example the contents of snps.vcf and indels.vcf are combined.

bgzip snps.vcf
bgzip indels.vcf
tabix -p vcf snps.vcf.gz
tabix -p vcf indels.vcf.gz
bcftools concat --allow-overlaps \
snps.vcf.gz \
indels.vcf.gz \
-Oz -o snps_and_indels.vcf.gz

Convert a VCF file to an Excel file

First remove header content:

grep -v '^##' input.vcf > input.tsv

Then use VisiData to convert the TSV file to an Excel file:

vd input.tsv -b -o input.xlsx

Count genotypes

Use --geno-counts in plink2:

plink2 --vcf snps.vcf --geno-counts 'cols=chrom,pos,ref,alt,homref,refalt,altxy,hapref,hapalt,missing' --allow-extra-chr --chr-set 95

Or use bcftools. First split multiallelic sites into biallelic records using bcftools norm:

bgzip snps.vcf
tabix -fp vcf snps.vcf.gz
bcftools norm -m-any snps.vcf.gz -Oz > snps.norm.vcf.gz

Then generate a CSV report providing genotype counts for each variant:

INPUT=snps.norm.vcf.gz
OUTPUT=snps.norm.vcf.genotype.counts.csv

paste \
<(bcftools view "$INPUT" | awk -F"\t" 'BEGIN {print "CHR\tPOS\tID\tREF\tALT"} !/^#/ {print $1"\t"$2"\t"$3"\t"$4"\t"$5}') \
<(bcftools query -f '[\t%SAMPLE=%GT]\n' "$INPUT" | awk 'BEGIN {print "nHomRef"} {print gsub(/0\|0|0\/0/, "")}') \
<(bcftools query -f '[\t%SAMPLE=%GT]\n' "$INPUT" | awk 'BEGIN {print "nHet"} {print gsub(/0\|1|1\|0|0\/1|1\/0/, "")}') \
<(bcftools query -f '[\t%SAMPLE=%GT]\n' "$INPUT" | awk 'BEGIN {print "nHomAlt"} {print gsub(/1\|1|1\/1/, "")}') \
| sed 's/,\t/\t/g' | sed 's/,$//g' > "$OUTPUT"

In some cases a good alternative is to use bcftools to calculate additional INFO tags from the genotypes. The following adds AC_Hom and AC_Het tags to the VCF file.

bgzip source.vcf
tabix -fp vcf source.vcf.gz
bcftools +fill-tags source.vcf.gz -Oz -o source.additional-fields.vcf.gz -- -t AC_Hom,AC_Het

Use --mendel in plink.

First convert the VCF file to a plink binary fileset:

species=dog
pseudoX_start=340475
pseudoX_end=6642728
mkdir plink_bed
plink --vcf input.vcf --make-bed --allow-extra-chr \
--$species --split-x $pseudoX_start $pseudoX_end \
--out plink_bed/input

Next edit the .fam file in plink_bed to describe family relationships, sex, and case / control status.

The following is from the plink documentation:

A text file with no header line, and one line per sample with the following six fields:

Family ID ('FID') Within-family ID ('IID'; cannot be '0') Within-family ID of father ('0' if father isn't in dataset) Within-family ID of mother ('0' if mother isn't in dataset) Sex code ('1' = male, '2' = female, '0' = unknown) Phenotype value ('1' = control, '2' = case, '-9'/'0'/non-numeric = missing data if case/control)

Use --mendel:

mkdir plink_mendelian_errors
plink --bfile plink_bed/input --mendel --geno 0 --allow-extra-chr \
--$species --out plink_mendelian_errors/input
cat plink_mendelian_errors/input.imendel

Count sites

grep -c -v '^#' input.ann.vcf

Or:

zgrep -c -v '^#' input.ann.vcf.gz

Determine genotype concordance

Use bcftools:

bgzip A.vcf
tabix -fp vcf A.vcf.gz

bgzip B.vcf
tabix -fp vcf B.vcf.gz

bcftools gtcheck -g A.vcf.gz B.vcf.gz

Or use SnpSift:

java -jar SnpSift.jar concordance A.vcf B.vcf

Or use Picard. In this example the comparison is limited to the sample named HOCANF12689774:

java -jar ~/bin/picard.jar GenotypeConcordance \
CALL_VCF=A.vcf \
CALL_SAMPLE=HOCANF12689774 \
O=gc_concordance.vcf \
TRUTH_VCF=B.vcf \
TRUTH_SAMPLE=HOCANF12689774

Determine the proportion of missing genotypes in each sample

INPUT=SNPs.vcf
paste \
<(bcftools query -f '[%SAMPLE\t]\n' "$INPUT" | head -1 | tr '\t' '\n') \
<(bcftools query -f '[%GT\t]\n' "$INPUT" | awk -v OFS="\t" '{for (i=1;i<=NF;i++) if ($i == "./.") sum[i]+=1 } END {for (i in sum) print i, sum[i] / NR }' | sort -k1,1n | cut -f 2)

The above produces output like:

sample1 0.956705
sample2 0.124076
sample3 0.0281456

Extract biallelic SNPs

bgzip input.vcf
tabix -fp vcf input.vcf.gz
bcftools view -Oz --min-alleles 2 --max-alleles 2 --types snps --output-file biallelic-snp.vcf.gz input.vcf.gz

Extract indels

bgzip input.vcf
tabix -fp vcf input.vcf.gz
bcftools view -Oz --types indels --output-file indels.vcf.gz input.vcf.gz

Extract sites found in all VCF files

In this example there are 5 VCF files in the directory vcfs.

Prepare index files:

cd vcfs
find . -name "*.vcf" -exec bgzip {} \;
find . -name "*.vcf.gz" -exec tabix -p vcf {} \;

Determine the intersection (change 5 to match the number of input files):

mkdir overlaps
bcftools isec -p overlaps \
-n=5 -c all -w1 \
*.vcf.gz
mv overlaps/0000.vcf overlaps/intersection.vcf

Count the number of variants in overlaps/intersection.vcf:

grep -c -v '^#' overlaps/intersection.vcf

Extract sites found in either but not both VCFs

Use the bcftools isec command.

Extract records private to A or B comparing by position only:

bcftools isec -p dir -n-1 -c all A.vcf.gz B.vcf.gz

Extract sites from the first file that are found in the second

Use the bcftools isec command.

Extract and write records from A shared by both A and B using exact allele match:

bcftools isec -p dir -n=2 -w1 A.vcf.gz B.vcf.gz

Extract sites not found in a second VCF

Use the bcftools isec command.

bcftools isec --complement -c some \
file1.vcf.gz \
file2.vcf.gz \
-p sites-in-file-1-not-in-file-2

The sites in file1.vcf.gz that are not in file2.vcf.gz can be found in sites-in-file-1-not-in-file-2/0000.vcf.

The -c some causes sites to be considered equivalent when some subset of ALT alleles match. To require identical REF and ALT alleles use -c none. To match based only on position, use -c all.

Extract SNPs

bgzip input.vcf
tabix -fp vcf input.vcf.gz
bcftools view -Oz --types snps --output-file snp.vcf.gz input.vcf.gz

Extract variants from a region of interest

Note that if the VCF file is gzip compressed (i.e. has a .gz extension), use --gzvcf instead of --vcf.

vcftools --vcf Chr5.vcf --out Chr5_filtered --chr 5 --from-bp 1 --to-bp 100000 --recode --recode-INFO-all

Extract variants from multiple regions of interest

bgzip Chr5.vcf
tabix -p vcf Chr5.vcf.gz
bcftools view -r 5:1-10000,5:200000-210000 -o output.vcf Chr5.vcf.gz

Extract variants from multiple regions of interest described in a file

In this example the regions of interest are stored in a text file called regions.txt. Each line describes the chromosome, start, and end of a region:

3 62148416 62200719
4 54643953 54720351
4 63732381 63795159
5 10163746 10218801
5 10784272 10841310
bgzip input.vcf
tabix -p vcf input.vcf.gz
tabix --print-header -R regions.txt input.vcf.gz > regions_of_interest.vcf

Extract variants where FILTER is PASS

Use SnpSift to filter VCF files.

The following keeps variants that have a FILTER value of PASS:

cat input.vcf | SnpSift filter "( FILTER = 'PASS' )" > input.PASS.vcf

Or, use bcftools:

bcftools view -f PASS input.vcf > input.PASS.vcf

Extract variants with a missing ID

awk -F $'\t' '$1 ~ /^#/ {print; next} $3~/^\./' input.vcf > input.noID.vcf

Extract variants with an assigned ID

awk -F $'\t' '$1 ~ /^#/ {print; next} $3~/^\./ {next} {print}' input.vcf > input.ID.vcf

Filter sites based on genotypes and other criteria

Use bcftools view to filter sites based on an expression. Sites for which the expression is true can be kept using the -i option or excluded using the -e option.

In the following example, sites are excluded (-e) if any sample is homozygous for an alternate allele and has a genotype quality greater than 30 (note that the & operator is used to indicate that both conditions must be met within a single sample):

bcftools view -e 'GT[*]="AA" & GQ[*]>30' SNPs.vcf

In the following example, sites are kept (-i) if the first sample is heterozygous with one reference allele and one alternate allele and the second sample is homozygous for an alternate allele (note that the && operator is used to indicate that the conditions can be met in different samples):

bcftools view -i 'GT[0]="RA" && GT[1]="AA"' SNPs.vcf

SnpSift can also be used to filter VCF files based on sample genotypes.

The following approach can be used to exclude sites where any sample meets the following criteria: is homozygous and the genotype quality is greater than 30 and the genotype is not 0/0. Worded another way, a site is kept if no sample exhibits a good-quality homozygous alternate genotype.

In this example there are 6 samples in the VCF file.

First generate the filter string:

FILTER=$(perl -e '@array = (); foreach(0..5) {push @array, "( isHom( GEN[$_] ) & GEN[$_].GQ > 30 & isVariant( GEN[$_] ) )";} print " !( " . join(" | ", @array) . " )\n";')

Examine the filter string:

echo $FILTER

This produces:

!( ( isHom( GEN[0] ) & GEN[0].GQ > 30 & isVariant( GEN[0] ) ) | ( isHom( GEN[1] ) & GEN[1].GQ > 30 & isVariant( GEN[1] ) ) | ( isHom( GEN[2] ) & GEN[2].GQ > 30 & isVariant( GEN[2] ) ) | ( isHom( GEN[3] ) & GEN[3].GQ > 30 & isVariant( GEN[3] ) ) | ( isHom( GEN[4] ) & GEN[4].GQ > 30 & isVariant( GEN[4] ) ) | ( isHom( GEN[5] ) & GEN[5].GQ > 30 & isVariant( GEN[5] ) ) )

Use the filter string and SnpSift.jar to complete the filtering step (the set +H is used so that the ! in the filter string doesn't activate Bash history expansion):

set +H
cat snps.vcf | java -jar SnpSift.jar filter "$FILTER" > snps_with_no_homozygous_alt_genotypes.vcf
set -H

Filter variants based on predicted consequences

Use SnpSift to filter VCF files that have been annotated using SnpEff.

The following keeps variants that are predicted to have HIGH or MODERATE impacts:

cat input.ann.vcf | SnpSift filter "((ANN[*].IMPACT = 'HIGH') | (ANN[*].IMPACT = 'MODERATE'))" > input.ann.high_or_moderate.vcf

Use --homozyg in plink.

First convert the VCF file to a plink binary fileset:

species=dog
pseudoX_start=340475
pseudoX_end=6642728
mkdir plink_bed
plink --vcf input.vcf --make-bed --allow-extra-chr \
--$species --split-x $pseudoX_start $pseudoX_end \
--out plink_bed/input

Next edit the .fam file in plink_bed to describe family relationships, sex, and case / control status.

The following is from the plink documentation:

A text file with no header line, and one line per sample with the following six fields:

Family ID ('FID') Within-family ID ('IID'; cannot be '0') Within-family ID of father ('0' if father isn't in dataset) Within-family ID of mother ('0' if mother isn't in dataset) Sex code ('1' = male, '2' = female, '0' = unknown) Phenotype value ('1' = control, '2' = case, '-9'/'0'/non-numeric = missing data if case/control)

Next, create a text file containing the Family ID and Within-family ID of each sample to be included in the analysis.

In this example the file roh_samples.txt consists of:

family1 M-2
family4 M-9
family3 M-10
family2 M-15
family2 M-16
family1 M-3
family1 M-4
family1 M-5

Use --homozyg:

mkdir plink_roh
cd plink_roh
plink --bfile ../plink_bed/input \
--homozyg group extend \
--$species \
--keep roh_samples.txt \
--allow-extra-chr \
--homozyg-snp 50 \
--homozyg-kb 100 \
--homozyg-density 2 \
--homozyg-gap 100 \
--homozyg-window-snp 50 \
--homozyg-window-het 2 \
--homozyg-window-missing 10 \
--homozyg-window-threshold 0.05

The plink.hom.overlap file in plink_roh can be filtered to, for example, obtain regions of homozygosity that are found in 5 cases and 0 controls:

awk '{ if ($2 == "CON" && $4 == "5:0") print $5" "$8" "$9 }' plink.hom.overlap > plink.hom.overlap.filtered

Variants in the filtered regions of homozygosity can be extracted from the VCF file:

bgzip input.vcf
tabix -p vcf input.vcf.gz
tabix --print-header -R plink_roh/plink.hom.overlap.filtered \
input.vcf.gz > input.hom.vcf

Interpreting INFO tags

Suppose a site has one ALT allele and the following genotype counts: 4627 homozygous REF, 429 heterozygous, and 60 homozygous ALT.

The resulting tag values are as follows:

  • AC = 549 = 429 + (60 * 2); this is the number of ALT alleles in the genotypes.
  • AN = 10232 = (4627 + 429 + 60) * 2; this is the number of alleles in the genotypes.
  • AF = AC / AN = 549 / 10232 = 0.054; this is the frequency of the ALT allele.
  • AC_Het = 429 = the number of ALT alleles in heterozygous genotypes = the number of heterozygous genotypes.
  • AC_Hom = 120 is the number of ALT alleles in homozygous genotypes = 2 * the number of homozygous ALT genotypes.
  • MAF = 0.054 = the lesser of AF or 1 - AF.
  • NS = 5116 = AN / 2.

Keep a subset of samples

In this example the samples to keep are in a text file called sample_list.txt, one sample per line. The --min-ac option is used to remove sites that are monomorphic in the subset of samples:

bcftools view input.vcf.gz -Oz --samples-file sample_list.txt --min-ac=1 --output-file output.vcf.gz

Keep sites from chromosomes and reheader based on reference genome

The following is used to create a new VCF file containing sites from chromosomes 1 to 18 and X and MT. The VCF header is then updated using a sequence dictionary from a reference genome.

The starting VCF is input.vcf.gz. The reference genome is reference.fa. The final output VCF is filtered.reheadered.vcf.gz.

This uses GATK, bcftools, and tabix.

# create index files incase they don't exist
samtools faidx reference.fa
tabix -p vcf input.vcf.gz

# create sequence dictionary
docker pull broadinstitute/gatk
docker run -it --rm \
-u "$(id -u)":"$(id -g)" \
-v "$(pwd)":/directory \
-w /directory \
broadinstitute/gatk \
  gatk CreateSequenceDictionary\
    -R reference.fa \
    -O reference.dict

# extract sites from chromosomes 1 to 18, X, and MT
bcftools view -r 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,X,Y,MT \
input.vcf.gz -o filtered.vcf.gz -O z

tabix -p vcf filtered.vcf.gz

# reheader VCF using sequence dictionary
docker run -it --rm \
-u "$(id -u)":"$(id -g)" \
-v "$(pwd)":/directory \
-w /directory \
broadinstitute/gatk \
  gatk UpdateVCFSequenceDictionary \
    -V filtered.vcf.gz \
    -R reference.fa \
    --output filtered.reheadered.vcf.gz \
    --replace true

tabix -p vcf filtered.reheadered.vcf.gz

Keep sites that are homozygous reference in all samples

Use bcftools view to filter sites based on an expression. Sites for which the expression is true can be kept using the -i option or excluded using the -e option.

In the following example, sites are kept (-i) if all 10 samples are homozygous for the reference allele:

bcftools view -i 'COUNT(GT="RR")=10' variants.vcf.gz

In the following example, sites are removed (-e) if any sample contains an alternate allele:

bcftools view -e 'GT[*]="alt"' variants.vcf.gz

Merge files from non-overlapping sample sets

From the bcftools merge documentation:

Merge multiple VCF/BCF files from non-overlapping sample sets to create one multi-sample file. For example, when merging file A.vcf.gz containing samples S1, S2 and S3 and file B.vcf.gz containing samples S3 and S4, the output file will contain four samples named S1, S2, S3, 2:S3 and S4.

bcftools merge *.vcf.gz -Oz -o merged.vcf.gz

Merge VCF files in batches using Slurm

In this example VCF files are merged in batches by submitting jobs to Slurm using sbatch. The advantage of this approach is that bcftools merge commands are run in parallel, so that results can be obtained more quickly.

The input files for this example are as follows:

21297.haplotypecaller.vcf.gz      23019.haplotypecaller.vcf.gz      23991.haplotypecaller.vcf.gz
21297.haplotypecaller.vcf.gz.tbi  23019.haplotypecaller.vcf.gz.tbi  23991.haplotypecaller.vcf.gz.tbi
21987.haplotypecaller.vcf.gz      23955.haplotypecaller.vcf.gz      24315.haplotypecaller.vcf.gz
21987.haplotypecaller.vcf.gz.tbi  23955.haplotypecaller.vcf.gz.tbi  24315.haplotypecaller.vcf.gz.tbi

First create an sbatch script called merge-vcfs.sbatch (replace someuser with your username):

#!/bin/bash
#SBATCH --account=def-someuser
#SBATCH --time=0:30:0
#SBATCH --ntasks=1
#SBATCH --mem=1000M

module load bcftools
module load tabix

output="$1"
shift

bcftools merge "$@" -Oz -o $output.merged.vcf.gz
tabix -p vcf $output.merged.vcf.gz

Note that the resource requirements may need to be adjusted depending on the number of input files to be processed in each group and their sizes.

merge-vcfs.sbatch uses bcftools to merge the input files and tabix to index the resulting merged VCF file. The first argument to merge-vcfs.sbatch is used to construct the output file name and the remaining arguments are used as the input files.

parallel can then be used to submit jobs that apply merge-vcfs.sbatch to batches of input files. The --dryrun option causes parallel to print out the commands instead of running them. The --delay 1 inserts a one second delay between printing or running jobs:

# You will likely want to increase batch_size to something like 50
batch_size=4
parallel --dryrun --delay 1 -j 1 \
-N $batch_size "sbatch -o {#}.merged.out -e {#}.merged.err merge-vcfs.sbatch {#} {} " ::: *.haplotypecaller.vcf.gz

The ::: *.haplotypecaller.vcf.gz and batch_size=4 lead to one sbatch command being constructed per group of four .haplotypecaller.vcf.gz files in the current directory. The final group may contain fewer than four files depending on the total number of input files, which is fine.

Each instance of {#} gets replaced with the job sequence number (1, 2, 3, etc.), and is used to construct unique filenames for each group of input files. The {} is replaced with the names of the files in the current group.

To submit the jobs, run the parallel command again, but without the --dryrun option:

parallel --delay 1 -j 1 \
-N $batch_size "sbatch -o {#}.merged.out -e {#}.merged.err merge-vcfs.sbatch {#} {} " ::: *.haplotypecaller.vcf.gz

Once the jobs are submitted their statuses can be checked using squeue (replace username with your username):

squeue -u username

Each job creates four files, for example:

1.merged.err
1.merged.out
1.merged.vcf.gz
1.merged.vcf.gz.tbi

The .out files and .err files are expected to be empty for these jobs. To quickly check the .err files, which contain any errors or warnings generated by the jobs, use:

cat *.err | more

Once all the jobs are complete, the output VCF files can be merged again to produce the final VCF file. For use in this merging step it may be necessary to construct a modified version of merge-vcfs.sbatch that requests additional resources. In this example we will use the same merge-vcfs.sbatch script as before:

sbatch -o final.merged.out -e final.merged.err merge-vcfs.sbatch final *.merged.vcf.gz

The final merged file will be named final.merged.vcf.gz.

Merge VCF files in batches using Slurm and a job array

In this example VCF files are merged in batches by submitting one job array to Slurm using sbatch. Using a job array instead of a large number of separate serial jobs can make it easier to monitor jobs and can make the scheduler run more efficiently.

The input files for this example are as follows:

21297.haplotypecaller.vcf.gz      23019.haplotypecaller.vcf.gz      23991.haplotypecaller.vcf.gz
21297.haplotypecaller.vcf.gz.tbi  23019.haplotypecaller.vcf.gz.tbi  23991.haplotypecaller.vcf.gz.tbi
21987.haplotypecaller.vcf.gz      23955.haplotypecaller.vcf.gz      24315.haplotypecaller.vcf.gz
21987.haplotypecaller.vcf.gz.tbi  23955.haplotypecaller.vcf.gz.tbi  24315.haplotypecaller.vcf.gz.tbi

First create an sbatch script called merge-vcfs-job-array.sbatch (replace someuser with your username):

#!/bin/bash

# SLURM directives
#SBATCH --account=def-someuser
#SBATCH --time=0:30:0
#SBATCH --ntasks=1
#SBATCH --mem=1000M

# Load required modules
module load bcftools
module load tabix

# Script arguments
FILE_LIST="$1"
BATCH_SIZE="$2"
OUTPUT_PREFIX="$3"

# Compute index based on SLURM_ARRAY_TASK_ID
INDEX=$((SLURM_ARRAY_TASK_ID * BATCH_SIZE))
OUTPUT="${SLURM_ARRAY_TASK_ID}.${OUTPUT_PREFIX}"

# Initialize empty array for input files
INPUT_FILES=()

# Populate INPUT_FILES array based on FILE_LIST and computed index
for ((i=0; i<BATCH_SIZE; i++)); do
    FILE_TO_ADD="$(sed -n "$((INDEX + i + 1))p" $FILE_LIST)"
    if [[ -n $FILE_TO_ADD ]]; then
        INPUT_FILES+=("$FILE_TO_ADD")
    fi
done

# Merge VCF files using bcftools and index the result with tabix
bcftools merge "${INPUT_FILES[@]}" -Oz -o $OUTPUT.vcf.gz
tabix -p vcf $OUTPUT.vcf.gz

Note that the resource requirements may need to be adjusted depending on the number of input files to be processed in each group and their sizes.

Now perform some calculations and submit the job array:

# This computes the ceiling of total_files/batch_size
# You will likely want to increase batch_size to something like 50
batch_size=4
total_files=$(ls *.haplotypecaller.vcf.gz | wc -l)
num_tasks=$(( (total_files + batch_size - 1) / batch_size ))
echo "Will submit $num_tasks tasks for $total_files files"

# Create file list
ls *.haplotypecaller.vcf.gz > file_list.txt

# Submit the job array
sbatch --array=0-$((num_tasks - 1)) \
-o %a.merged.out \
-e %a.merged.err \
merge-vcfs-job-array.sbatch file_list.txt $batch_size merged

Once the job array is submitted its status can be checked using squeue (replace username with your username):

squeue -u username

Each task in the job creates four files, for example:

0.merged.err
0.merged.out
0.merged.vcf.gz
0.merged.vcf.gz.tbi

The .out files and .err files are expected to be empty for these jobs. To quickly check the .err files, which contain any errors or warnings generated by the jobs, use:

cat *.err | more

Once all the tasks are complete, the output VCF files can be merged again to produce the final VCF file. For use in this merging step it may be necessary to construct a modified version of merge-vcfs-job-array.sbatch that requests additional resources. In this example we will use the same merge-vcfs-job-array.sbatch script as before:

# Calculate number of files to merge
final_merge_batch_size=$(ls *.merged.vcf.gz | wc -l)
echo "Will submit 1 task for $final_merge_batch_size files"

# Create file list for final merge
ls *.merged.vcf.gz > final_merge_file_list.txt

# Submit a job array with a single task
sbatch --array=0 \
-o %a.final.merged.out \
-e %a.final.merged.err \
merge-vcfs-job-array.sbatch final_merge_file_list.txt $final_merge_batch_size final.merged

The final merged file will be named 0.final.merged.vcf.gz.

Perform case-control analysis

SnpSift can generate p-values for different models.

In this example the +++++ specifies that the first five samples are cases. The ------- specifies that the next seven samples are controls. The 000 specifies that the last three samples should be ignored.

cat input.vcf | java -jar SnpSift.jar caseControl "+++++-------000" > input.case-control.vcf

The results can be filtered based on p-value. The following keeps variants where the p-value under the recessive model is less than 0.001:

cat input.case-control.vcf | java -jar SnpSift.jar filter "CC_REC[0] < 0.001" > input.case-control.sig.vcf
bcftools query -l input.vcf.gz

Or:

bcftools query -l input.vcf

Remove a sample

In this example sample GM-2 is removed:

vcftools --remove-indv GM-2 --vcf input.vcf --recode --out output.vcf

Remove all genotypes

bgzip input.vcf
tabix -p vcf input.vcf.gz
bcftools view -G input.vcf.gz -Oz -o output.vcf.gz

Or:

bcftools view -G input.vcf > output.vcf

Remove annotations

Use bcftools annotate.

The following removes all INFO fields and all FORMAT fields except for GT and GQ:

bcftools annotate -x INFO,^FORMAT/GT,FORMAT/GQ input.vcf > input_GT_GQ.vcf

Remove sites that are homozygous reference in all samples

Use bcftools view to filter sites based on an expression. Sites for which the expression is true can be kept using the -i option or excluded using the -e option.

In the following example, sites are removed (-e) if all 10 samples are homozygous for the reference allele:

bcftools view -e 'COUNT(GT="RR")=10' variants.vcf.gz

In the following example, sites are kept (-i) if any sample contains an alternate allele:

bcftools view -i 'GT[*]="alt"' variants.vcf.gz

Remove sites with any missing genotypes

bcftools view -e 'GT[*]="mis"' input.vcf > output.vcf

Rename samples

In this example the new sample names are in the file new_sample_names.txt, one name per line, in the same order as they appear in the VCF file:

bcftools reheader input.vcf.gz --samples new_sample_names.txt --output output.vcf.gz 

Transfer annotations from another VCF

In this example some annotations are added to the file source.vcf (calculated from genotypes) and then annotations are transferred to the file input.vcf. The results are written to output.vcf.

The transfer of annotations is done using vcfanno.

This procedure is useful for annotating variants in one file with information obtained, for example, from a much larger population of samples. The resulting tags can be used in downstream filtering operations.

First fill some additional annotation fields to source.vcf:

bgzip source.vcf
tabix -fp vcf source.vcf.gz
bcftools +fill-tags source.vcf.gz -Oz -o source.additional-fields.vcf.gz -- -t AC_Hom,AC_Het

Create a config.toml file for vcfanno:

[[annotation]]
file="source.additional-fields.vcf.gz"
fields=["AF", "AC_Hom", "AC_Het"]
names=["source.AF", "source.AC_Hom", "source.AC_Het"]
ops=["self", "self", "self"]

Prepare the input.vcf file:

bgzip input.vcf
tabix -fp vcf input.vcf.gz

Create an index for source.additional-fields.vcf.gz:

tabix -fp vcf source.additional-fields.vcf.gz

Perform the annotation transfer:

vcfanno config.toml input.vcf.gz > out.vcf

The file out.vcf should now include INFO tags source.AF, source.AC_Hom, and source.AC_Het with values calculated from the samples in source.vcf.

vim

Check the value of a setting

To check the value of a setting, in this example the paste setting, use:

:set paste?

Or:

echo &paste

Compare two files

vimdiff file1 file2

Copy to the clipboard

"+y

Paste text without auto-indenting

First, turn on paste mode so that auto-indenting is turned off:

:set paste

Now paste the text.

Then turn off paste mode:

:set nopaste

To allow quick toggling of paste mode using F2, add the following to .vimrc:

set pastetoggle=<F2>

Now you can avoid auto-indenting of pasted text as follows: press F2, paste the text, press F2 again.

Remove trailing whitespace

:%s/\s\+$//e

Search and replace across multiple files

In this example search and replace operations are performed on all the .html files in a directory. First, open the files in multiple buffers in vim:

vim *.html

Then use argdo to perform a search and replace across all the files. In this example blank lines are removed:

:argdo %s/^$//ge

In this example the text between <p class="last-updated"> and </p> are replaced with the current date. Note the use of \zs and \ze so that the text between those tags is replaced and not the tags themselves:

:argdo %s/<p class="last-updated">\zs[^<]*\ze<\/p>/\=strftime("%c")/ge

Search and replace newlines

In replacement syntax use \r instead of \n to represent newlines. For example, to replace commas with newlines:

:%s/,/\r/g

Type tab characters

In insert mode type Ctrl-v then tab.

View ^M characters

:e ++ff=unix